ID: 1189588339

View in Genome Browser
Species Human (GRCh38)
Location X:42484986-42485008
Sequence GTGGTGTGTGCTGGGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189588339_1189588350 27 Left 1189588339 X:42484986-42485008 CCAGCATTCCCAGCACACACCAC No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data
1189588339_1189588351 30 Left 1189588339 X:42484986-42485008 CCAGCATTCCCAGCACACACCAC No data
Right 1189588351 X:42485039-42485061 CATTACCACCACCCCATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189588339 Original CRISPR GTGGTGTGTGCTGGGAATGC TGG (reversed) Intergenic
No off target data available for this crispr