ID: 1189588340

View in Genome Browser
Species Human (GRCh38)
Location X:42484994-42485016
Sequence ACAAAAGGGTGGTGTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189588340_1189588353 27 Left 1189588340 X:42484994-42485016 CCCAGCACACACCACCCTTTTGT No data
Right 1189588353 X:42485044-42485066 CCACCACCCCATAGGAGGCATGG No data
1189588340_1189588350 19 Left 1189588340 X:42484994-42485016 CCCAGCACACACCACCCTTTTGT No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data
1189588340_1189588351 22 Left 1189588340 X:42484994-42485016 CCCAGCACACACCACCCTTTTGT No data
Right 1189588351 X:42485039-42485061 CATTACCACCACCCCATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189588340 Original CRISPR ACAAAAGGGTGGTGTGTGCT GGG (reversed) Intergenic
No off target data available for this crispr