ID: 1189588341

View in Genome Browser
Species Human (GRCh38)
Location X:42484995-42485017
Sequence CACAAAAGGGTGGTGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189588341_1189588350 18 Left 1189588341 X:42484995-42485017 CCAGCACACACCACCCTTTTGTG No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data
1189588341_1189588353 26 Left 1189588341 X:42484995-42485017 CCAGCACACACCACCCTTTTGTG No data
Right 1189588353 X:42485044-42485066 CCACCACCCCATAGGAGGCATGG No data
1189588341_1189588351 21 Left 1189588341 X:42484995-42485017 CCAGCACACACCACCCTTTTGTG No data
Right 1189588351 X:42485039-42485061 CATTACCACCACCCCATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189588341 Original CRISPR CACAAAAGGGTGGTGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr