ID: 1189588343

View in Genome Browser
Species Human (GRCh38)
Location X:42485005-42485027
Sequence AAGGGAGAGCCACAAAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189588343_1189588353 16 Left 1189588343 X:42485005-42485027 CCACCCTTTTGTGGCTCTCCCTT No data
Right 1189588353 X:42485044-42485066 CCACCACCCCATAGGAGGCATGG No data
1189588343_1189588359 27 Left 1189588343 X:42485005-42485027 CCACCCTTTTGTGGCTCTCCCTT No data
Right 1189588359 X:42485055-42485077 TAGGAGGCATGGCTAGGACTTGG No data
1189588343_1189588355 21 Left 1189588343 X:42485005-42485027 CCACCCTTTTGTGGCTCTCCCTT No data
Right 1189588355 X:42485049-42485071 ACCCCATAGGAGGCATGGCTAGG No data
1189588343_1189588351 11 Left 1189588343 X:42485005-42485027 CCACCCTTTTGTGGCTCTCCCTT No data
Right 1189588351 X:42485039-42485061 CATTACCACCACCCCATAGGAGG No data
1189588343_1189588350 8 Left 1189588343 X:42485005-42485027 CCACCCTTTTGTGGCTCTCCCTT No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189588343 Original CRISPR AAGGGAGAGCCACAAAAGGG TGG (reversed) Intergenic
No off target data available for this crispr