ID: 1189588350

View in Genome Browser
Species Human (GRCh38)
Location X:42485036-42485058
Sequence CTACATTACCACCACCCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189588341_1189588350 18 Left 1189588341 X:42484995-42485017 CCAGCACACACCACCCTTTTGTG No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data
1189588340_1189588350 19 Left 1189588340 X:42484994-42485016 CCCAGCACACACCACCCTTTTGT No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data
1189588345_1189588350 4 Left 1189588345 X:42485009-42485031 CCTTTTGTGGCTCTCCCTTCACT No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data
1189588344_1189588350 5 Left 1189588344 X:42485008-42485030 CCCTTTTGTGGCTCTCCCTTCAC No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data
1189588339_1189588350 27 Left 1189588339 X:42484986-42485008 CCAGCATTCCCAGCACACACCAC No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data
1189588343_1189588350 8 Left 1189588343 X:42485005-42485027 CCACCCTTTTGTGGCTCTCCCTT No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data
1189588346_1189588350 -10 Left 1189588346 X:42485023-42485045 CCCTTCACTCACCCTACATTACC No data
Right 1189588350 X:42485036-42485058 CTACATTACCACCACCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189588350 Original CRISPR CTACATTACCACCACCCCAT AGG Intergenic
No off target data available for this crispr