ID: 1189590461

View in Genome Browser
Species Human (GRCh38)
Location X:42505742-42505764
Sequence TCAGAGCCTCTGTAAAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189590461_1189590463 -1 Left 1189590461 X:42505742-42505764 CCTGTATTTTACAGAGGCTCTGA No data
Right 1189590463 X:42505764-42505786 AGAGATTTGGAAGCAGAATGAGG No data
1189590461_1189590464 3 Left 1189590461 X:42505742-42505764 CCTGTATTTTACAGAGGCTCTGA No data
Right 1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG No data
1189590461_1189590465 12 Left 1189590461 X:42505742-42505764 CCTGTATTTTACAGAGGCTCTGA No data
Right 1189590465 X:42505777-42505799 CAGAATGAGGATGGAGTAGAAGG No data
1189590461_1189590468 25 Left 1189590461 X:42505742-42505764 CCTGTATTTTACAGAGGCTCTGA No data
Right 1189590468 X:42505790-42505812 GAGTAGAAGGGATACCATCTGGG No data
1189590461_1189590466 13 Left 1189590461 X:42505742-42505764 CCTGTATTTTACAGAGGCTCTGA No data
Right 1189590466 X:42505778-42505800 AGAATGAGGATGGAGTAGAAGGG No data
1189590461_1189590467 24 Left 1189590461 X:42505742-42505764 CCTGTATTTTACAGAGGCTCTGA No data
Right 1189590467 X:42505789-42505811 GGAGTAGAAGGGATACCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189590461 Original CRISPR TCAGAGCCTCTGTAAAATAC AGG (reversed) Intergenic
No off target data available for this crispr