ID: 1189590464

View in Genome Browser
Species Human (GRCh38)
Location X:42505768-42505790
Sequence ATTTGGAAGCAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189590461_1189590464 3 Left 1189590461 X:42505742-42505764 CCTGTATTTTACAGAGGCTCTGA No data
Right 1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189590464 Original CRISPR ATTTGGAAGCAGAATGAGGA TGG Intergenic
No off target data available for this crispr