ID: 1189593146

View in Genome Browser
Species Human (GRCh38)
Location X:42536836-42536858
Sequence ACTCACACACTGTTGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189593135_1189593146 21 Left 1189593135 X:42536792-42536814 CCAGTACTCCCCCTAGCAGTCTG No data
Right 1189593146 X:42536836-42536858 ACTCACACACTGTTGGTAGGAGG No data
1189593137_1189593146 12 Left 1189593137 X:42536801-42536823 CCCCTAGCAGTCTGCACGAAGTG No data
Right 1189593146 X:42536836-42536858 ACTCACACACTGTTGGTAGGAGG No data
1189593136_1189593146 13 Left 1189593136 X:42536800-42536822 CCCCCTAGCAGTCTGCACGAAGT No data
Right 1189593146 X:42536836-42536858 ACTCACACACTGTTGGTAGGAGG No data
1189593138_1189593146 11 Left 1189593138 X:42536802-42536824 CCCTAGCAGTCTGCACGAAGTGG No data
Right 1189593146 X:42536836-42536858 ACTCACACACTGTTGGTAGGAGG No data
1189593140_1189593146 10 Left 1189593140 X:42536803-42536825 CCTAGCAGTCTGCACGAAGTGGG No data
Right 1189593146 X:42536836-42536858 ACTCACACACTGTTGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189593146 Original CRISPR ACTCACACACTGTTGGTAGG AGG Intergenic
No off target data available for this crispr