ID: 1189599342

View in Genome Browser
Species Human (GRCh38)
Location X:42605880-42605902
Sequence TGGTCCCCTAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189599342_1189599352 20 Left 1189599342 X:42605880-42605902 CCCACAGGGGGCTTAGGGGACCA No data
Right 1189599352 X:42605923-42605945 TGATTTAGCAAATAAAATACAGG No data
1189599342_1189599346 -10 Left 1189599342 X:42605880-42605902 CCCACAGGGGGCTTAGGGGACCA No data
Right 1189599346 X:42605893-42605915 TAGGGGACCATAGGGCCAATCGG No data
1189599342_1189599347 -9 Left 1189599342 X:42605880-42605902 CCCACAGGGGGCTTAGGGGACCA No data
Right 1189599347 X:42605894-42605916 AGGGGACCATAGGGCCAATCGGG No data
1189599342_1189599348 -8 Left 1189599342 X:42605880-42605902 CCCACAGGGGGCTTAGGGGACCA No data
Right 1189599348 X:42605895-42605917 GGGGACCATAGGGCCAATCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189599342 Original CRISPR TGGTCCCCTAAGCCCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr