ID: 1189601473

View in Genome Browser
Species Human (GRCh38)
Location X:42631020-42631042
Sequence CTGCCATATTTGAGTTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189601469_1189601473 12 Left 1189601469 X:42630985-42631007 CCAGACATACTGAAGGTTGGAAG No data
Right 1189601473 X:42631020-42631042 CTGCCATATTTGAGTTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189601473 Original CRISPR CTGCCATATTTGAGTTGAGG TGG Intergenic
No off target data available for this crispr