ID: 1189610416

View in Genome Browser
Species Human (GRCh38)
Location X:42727509-42727531
Sequence TGTGACTTTTTCAGCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189610416_1189610421 -7 Left 1189610416 X:42727509-42727531 CCAACCAGGCTGAAAAAGTCACA No data
Right 1189610421 X:42727525-42727547 AGTCACAACTTGTGGGGCACTGG No data
1189610416_1189610422 -6 Left 1189610416 X:42727509-42727531 CCAACCAGGCTGAAAAAGTCACA No data
Right 1189610422 X:42727526-42727548 GTCACAACTTGTGGGGCACTGGG No data
1189610416_1189610426 30 Left 1189610416 X:42727509-42727531 CCAACCAGGCTGAAAAAGTCACA No data
Right 1189610426 X:42727562-42727584 AAGTTCTTGCCTCAGTAGTGGGG No data
1189610416_1189610424 28 Left 1189610416 X:42727509-42727531 CCAACCAGGCTGAAAAAGTCACA No data
Right 1189610424 X:42727560-42727582 GGAAGTTCTTGCCTCAGTAGTGG No data
1189610416_1189610423 7 Left 1189610416 X:42727509-42727531 CCAACCAGGCTGAAAAAGTCACA No data
Right 1189610423 X:42727539-42727561 GGGCACTGGGTAGAGTACTCAGG No data
1189610416_1189610425 29 Left 1189610416 X:42727509-42727531 CCAACCAGGCTGAAAAAGTCACA No data
Right 1189610425 X:42727561-42727583 GAAGTTCTTGCCTCAGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189610416 Original CRISPR TGTGACTTTTTCAGCCTGGT TGG (reversed) Intergenic
No off target data available for this crispr