ID: 1189610421

View in Genome Browser
Species Human (GRCh38)
Location X:42727525-42727547
Sequence AGTCACAACTTGTGGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189610416_1189610421 -7 Left 1189610416 X:42727509-42727531 CCAACCAGGCTGAAAAAGTCACA No data
Right 1189610421 X:42727525-42727547 AGTCACAACTTGTGGGGCACTGG No data
1189610414_1189610421 13 Left 1189610414 X:42727489-42727511 CCAAGAATAGTGTGTTATCACCA No data
Right 1189610421 X:42727525-42727547 AGTCACAACTTGTGGGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189610421 Original CRISPR AGTCACAACTTGTGGGGCAC TGG Intergenic