ID: 1189610423

View in Genome Browser
Species Human (GRCh38)
Location X:42727539-42727561
Sequence GGGCACTGGGTAGAGTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189610417_1189610423 3 Left 1189610417 X:42727513-42727535 CCAGGCTGAAAAAGTCACAACTT No data
Right 1189610423 X:42727539-42727561 GGGCACTGGGTAGAGTACTCAGG No data
1189610416_1189610423 7 Left 1189610416 X:42727509-42727531 CCAACCAGGCTGAAAAAGTCACA No data
Right 1189610423 X:42727539-42727561 GGGCACTGGGTAGAGTACTCAGG No data
1189610414_1189610423 27 Left 1189610414 X:42727489-42727511 CCAAGAATAGTGTGTTATCACCA No data
Right 1189610423 X:42727539-42727561 GGGCACTGGGTAGAGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189610423 Original CRISPR GGGCACTGGGTAGAGTACTC AGG Intergenic