ID: 1189610424

View in Genome Browser
Species Human (GRCh38)
Location X:42727560-42727582
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189610416_1189610424 28 Left 1189610416 X:42727509-42727531 CCAACCAGGCTGAAAAAGTCACA No data
Right 1189610424 X:42727560-42727582 GGAAGTTCTTGCCTCAGTAGTGG No data
1189610417_1189610424 24 Left 1189610417 X:42727513-42727535 CCAGGCTGAAAAAGTCACAACTT No data
Right 1189610424 X:42727560-42727582 GGAAGTTCTTGCCTCAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189610424 Original CRISPR GGAAGTTCTTGCCTCAGTAG TGG Intergenic