ID: 1189610425 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:42727561-42727583 |
| Sequence | GAAGTTCTTGCCTCAGTAGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1189610417_1189610425 | 25 | Left | 1189610417 | X:42727513-42727535 | CCAGGCTGAAAAAGTCACAACTT | No data | ||
| Right | 1189610425 | X:42727561-42727583 | GAAGTTCTTGCCTCAGTAGTGGG | No data | ||||
| 1189610416_1189610425 | 29 | Left | 1189610416 | X:42727509-42727531 | CCAACCAGGCTGAAAAAGTCACA | No data | ||
| Right | 1189610425 | X:42727561-42727583 | GAAGTTCTTGCCTCAGTAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1189610425 | Original CRISPR | GAAGTTCTTGCCTCAGTAGT GGG | Intergenic | ||