ID: 1189612964

View in Genome Browser
Species Human (GRCh38)
Location X:42756167-42756189
Sequence CTGTAAACTCAGCTTGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189612964_1189612967 10 Left 1189612964 X:42756167-42756189 CCTACCACAAGCTGAGTTTACAG No data
Right 1189612967 X:42756200-42756222 TTGTGTTTAATCTGTCTTCTTGG No data
1189612964_1189612971 27 Left 1189612964 X:42756167-42756189 CCTACCACAAGCTGAGTTTACAG No data
Right 1189612971 X:42756217-42756239 TCTTGGTGAAGAGCTTGGGTGGG No data
1189612964_1189612970 26 Left 1189612964 X:42756167-42756189 CCTACCACAAGCTGAGTTTACAG No data
Right 1189612970 X:42756216-42756238 TTCTTGGTGAAGAGCTTGGGTGG No data
1189612964_1189612968 22 Left 1189612964 X:42756167-42756189 CCTACCACAAGCTGAGTTTACAG No data
Right 1189612968 X:42756212-42756234 TGTCTTCTTGGTGAAGAGCTTGG No data
1189612964_1189612972 28 Left 1189612964 X:42756167-42756189 CCTACCACAAGCTGAGTTTACAG No data
Right 1189612972 X:42756218-42756240 CTTGGTGAAGAGCTTGGGTGGGG No data
1189612964_1189612969 23 Left 1189612964 X:42756167-42756189 CCTACCACAAGCTGAGTTTACAG No data
Right 1189612969 X:42756213-42756235 GTCTTCTTGGTGAAGAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189612964 Original CRISPR CTGTAAACTCAGCTTGTGGT AGG (reversed) Intergenic
No off target data available for this crispr