ID: 1189613828

View in Genome Browser
Species Human (GRCh38)
Location X:42764796-42764818
Sequence GGAAACTCCCTCACCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189613818_1189613828 27 Left 1189613818 X:42764746-42764768 CCTCTGCTGTCCAAAAGTCAGTT No data
Right 1189613828 X:42764796-42764818 GGAAACTCCCTCACCTCTCTGGG No data
1189613819_1189613828 17 Left 1189613819 X:42764756-42764778 CCAAAAGTCAGTTACATAAAAGT No data
Right 1189613828 X:42764796-42764818 GGAAACTCCCTCACCTCTCTGGG No data
1189613823_1189613828 -9 Left 1189613823 X:42764782-42764804 CCAATACCCCAAAGGGAAACTCC No data
Right 1189613828 X:42764796-42764818 GGAAACTCCCTCACCTCTCTGGG No data
1189613822_1189613828 -8 Left 1189613822 X:42764781-42764803 CCCAATACCCCAAAGGGAAACTC No data
Right 1189613828 X:42764796-42764818 GGAAACTCCCTCACCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189613828 Original CRISPR GGAAACTCCCTCACCTCTCT GGG Intergenic
No off target data available for this crispr