ID: 1189613982

View in Genome Browser
Species Human (GRCh38)
Location X:42765698-42765720
Sequence ACCGGATGGCTCCTATAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189613975_1189613982 8 Left 1189613975 X:42765667-42765689 CCCACAATACTCCTATTCTCCCA No data
Right 1189613982 X:42765698-42765720 ACCGGATGGCTCCTATAGACTGG No data
1189613977_1189613982 -3 Left 1189613977 X:42765678-42765700 CCTATTCTCCCAATCAAAAAACC No data
Right 1189613982 X:42765698-42765720 ACCGGATGGCTCCTATAGACTGG No data
1189613974_1189613982 9 Left 1189613974 X:42765666-42765688 CCCCACAATACTCCTATTCTCCC No data
Right 1189613982 X:42765698-42765720 ACCGGATGGCTCCTATAGACTGG No data
1189613976_1189613982 7 Left 1189613976 X:42765668-42765690 CCACAATACTCCTATTCTCCCAA No data
Right 1189613982 X:42765698-42765720 ACCGGATGGCTCCTATAGACTGG No data
1189613973_1189613982 22 Left 1189613973 X:42765653-42765675 CCTCACTCATTCTCCCCACAATA No data
Right 1189613982 X:42765698-42765720 ACCGGATGGCTCCTATAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189613982 Original CRISPR ACCGGATGGCTCCTATAGAC TGG Intergenic