ID: 1189623464

View in Genome Browser
Species Human (GRCh38)
Location X:42869478-42869500
Sequence TAGGAAGATCTATGTATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189623460_1189623464 20 Left 1189623460 X:42869435-42869457 CCATTAGGCAATCATGCCATTAG No data
Right 1189623464 X:42869478-42869500 TAGGAAGATCTATGTATAACAGG No data
1189623462_1189623464 4 Left 1189623462 X:42869451-42869473 CCATTAGGCAATGATGTAGCAGT No data
Right 1189623464 X:42869478-42869500 TAGGAAGATCTATGTATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189623464 Original CRISPR TAGGAAGATCTATGTATAAC AGG Intergenic
No off target data available for this crispr