ID: 1189623655

View in Genome Browser
Species Human (GRCh38)
Location X:42871564-42871586
Sequence AAATTTATGCCGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189623655_1189623663 6 Left 1189623655 X:42871564-42871586 CCTCCCTCCCTCGGCATAAATTT No data
Right 1189623663 X:42871593-42871615 AGGAATGAAGAGTGTTGGAATGG No data
1189623655_1189623667 17 Left 1189623655 X:42871564-42871586 CCTCCCTCCCTCGGCATAAATTT No data
Right 1189623667 X:42871604-42871626 GTGTTGGAATGGGTCAGGGCAGG No data
1189623655_1189623666 13 Left 1189623655 X:42871564-42871586 CCTCCCTCCCTCGGCATAAATTT No data
Right 1189623666 X:42871600-42871622 AAGAGTGTTGGAATGGGTCAGGG No data
1189623655_1189623661 1 Left 1189623655 X:42871564-42871586 CCTCCCTCCCTCGGCATAAATTT No data
Right 1189623661 X:42871588-42871610 TCCTCAGGAATGAAGAGTGTTGG No data
1189623655_1189623664 7 Left 1189623655 X:42871564-42871586 CCTCCCTCCCTCGGCATAAATTT No data
Right 1189623664 X:42871594-42871616 GGAATGAAGAGTGTTGGAATGGG No data
1189623655_1189623665 12 Left 1189623655 X:42871564-42871586 CCTCCCTCCCTCGGCATAAATTT No data
Right 1189623665 X:42871599-42871621 GAAGAGTGTTGGAATGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189623655 Original CRISPR AAATTTATGCCGAGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr