ID: 1189628041

View in Genome Browser
Species Human (GRCh38)
Location X:42920688-42920710
Sequence ATGCCACACAGCTACTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189628041_1189628044 0 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628044 X:42920711-42920733 GAAGAGAAAATCTGTGTACTGGG No data
1189628041_1189628045 1 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628045 X:42920712-42920734 AAGAGAAAATCTGTGTACTGGGG No data
1189628041_1189628051 26 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG No data
1189628041_1189628048 6 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628048 X:42920717-42920739 AAAATCTGTGTACTGGGGGGAGG No data
1189628041_1189628046 2 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628046 X:42920713-42920735 AGAGAAAATCTGTGTACTGGGGG No data
1189628041_1189628047 3 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628047 X:42920714-42920736 GAGAAAATCTGTGTACTGGGGGG No data
1189628041_1189628049 7 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628049 X:42920718-42920740 AAATCTGTGTACTGGGGGGAGGG No data
1189628041_1189628050 25 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628050 X:42920736-42920758 GAGGGAGAGCACAGTGATCGTGG No data
1189628041_1189628043 -1 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628043 X:42920710-42920732 TGAAGAGAAAATCTGTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189628041 Original CRISPR ATGCCACACAGCTACTGCCA GGG (reversed) Intergenic
No off target data available for this crispr