ID: 1189628051

View in Genome Browser
Species Human (GRCh38)
Location X:42920737-42920759
Sequence AGGGAGAGCACAGTGATCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189628041_1189628051 26 Left 1189628041 X:42920688-42920710 CCCTGGCAGTAGCTGTGTGGCAT No data
Right 1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG No data
1189628042_1189628051 25 Left 1189628042 X:42920689-42920711 CCTGGCAGTAGCTGTGTGGCATG No data
Right 1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189628051 Original CRISPR AGGGAGAGCACAGTGATCGT GGG Intergenic
No off target data available for this crispr