ID: 1189628256

View in Genome Browser
Species Human (GRCh38)
Location X:42921980-42922002
Sequence TTGTGTCCTTCTCTTCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189628256_1189628265 19 Left 1189628256 X:42921980-42922002 CCACCCTGAAGAGAAGGACACAA No data
Right 1189628265 X:42922022-42922044 CTGTTGATTATAGGGCCCTAGGG No data
1189628256_1189628261 11 Left 1189628256 X:42921980-42922002 CCACCCTGAAGAGAAGGACACAA No data
Right 1189628261 X:42922014-42922036 TTTTCCACCTGTTGATTATAGGG No data
1189628256_1189628264 18 Left 1189628256 X:42921980-42922002 CCACCCTGAAGAGAAGGACACAA No data
Right 1189628264 X:42922021-42922043 CCTGTTGATTATAGGGCCCTAGG No data
1189628256_1189628260 10 Left 1189628256 X:42921980-42922002 CCACCCTGAAGAGAAGGACACAA No data
Right 1189628260 X:42922013-42922035 CTTTTCCACCTGTTGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189628256 Original CRISPR TTGTGTCCTTCTCTTCAGGG TGG (reversed) Intergenic
No off target data available for this crispr