ID: 1189629342

View in Genome Browser
Species Human (GRCh38)
Location X:42934781-42934803
Sequence GGGCTGAGGGGACCACAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189629334_1189629342 -8 Left 1189629334 X:42934766-42934788 CCTTGCCCCTACTGTGGGCTGAG No data
Right 1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG No data
1189629333_1189629342 -7 Left 1189629333 X:42934765-42934787 CCCTTGCCCCTACTGTGGGCTGA No data
Right 1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG No data
1189629330_1189629342 20 Left 1189629330 X:42934738-42934760 CCTTCATTATGAACTGTGGAGAA No data
Right 1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189629342 Original CRISPR GGGCTGAGGGGACCACAGCT GGG Intergenic
No off target data available for this crispr