ID: 1189630560

View in Genome Browser
Species Human (GRCh38)
Location X:42948102-42948124
Sequence CTCTGTGACCAATACAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189630558_1189630560 3 Left 1189630558 X:42948076-42948098 CCTTTTGTTCCAATTGGGTGTTC No data
Right 1189630560 X:42948102-42948124 CTCTGTGACCAATACAAAGTAGG No data
1189630555_1189630560 11 Left 1189630555 X:42948068-42948090 CCTGCTTGCCTTTTGTTCCAATT No data
Right 1189630560 X:42948102-42948124 CTCTGTGACCAATACAAAGTAGG No data
1189630559_1189630560 -6 Left 1189630559 X:42948085-42948107 CCAATTGGGTGTTCTTTCTCTGT No data
Right 1189630560 X:42948102-42948124 CTCTGTGACCAATACAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189630560 Original CRISPR CTCTGTGACCAATACAAAGT AGG Intergenic
No off target data available for this crispr