ID: 1189630560 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:42948102-42948124 |
| Sequence | CTCTGTGACCAATACAAAGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1189630558_1189630560 | 3 | Left | 1189630558 | X:42948076-42948098 | CCTTTTGTTCCAATTGGGTGTTC | No data | ||
| Right | 1189630560 | X:42948102-42948124 | CTCTGTGACCAATACAAAGTAGG | No data | ||||
| 1189630555_1189630560 | 11 | Left | 1189630555 | X:42948068-42948090 | CCTGCTTGCCTTTTGTTCCAATT | No data | ||
| Right | 1189630560 | X:42948102-42948124 | CTCTGTGACCAATACAAAGTAGG | No data | ||||
| 1189630559_1189630560 | -6 | Left | 1189630559 | X:42948085-42948107 | CCAATTGGGTGTTCTTTCTCTGT | No data | ||
| Right | 1189630560 | X:42948102-42948124 | CTCTGTGACCAATACAAAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1189630560 | Original CRISPR | CTCTGTGACCAATACAAAGT AGG | Intergenic | ||
| No off target data available for this crispr | |||||