ID: 1189633968

View in Genome Browser
Species Human (GRCh38)
Location X:42985373-42985395
Sequence ACGTGCCCATAGTGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189633963_1189633968 -5 Left 1189633963 X:42985355-42985377 CCCACTTCTGGGCATTCTACGTG No data
Right 1189633968 X:42985373-42985395 ACGTGCCCATAGTGGGTGGATGG No data
1189633960_1189633968 15 Left 1189633960 X:42985335-42985357 CCAGGTTTATGAAATCTTCACCC No data
Right 1189633968 X:42985373-42985395 ACGTGCCCATAGTGGGTGGATGG No data
1189633964_1189633968 -6 Left 1189633964 X:42985356-42985378 CCACTTCTGGGCATTCTACGTGC No data
Right 1189633968 X:42985373-42985395 ACGTGCCCATAGTGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189633968 Original CRISPR ACGTGCCCATAGTGGGTGGA TGG Intergenic
No off target data available for this crispr