ID: 1189639263

View in Genome Browser
Species Human (GRCh38)
Location X:43050420-43050442
Sequence ACCACCACCTGCTCTGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189639259_1189639263 -10 Left 1189639259 X:43050407-43050429 CCCAGCCATGGATACCACCACCT No data
Right 1189639263 X:43050420-43050442 ACCACCACCTGCTCTGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189639263 Original CRISPR ACCACCACCTGCTCTGGTAG AGG Intergenic