ID: 1189646333

View in Genome Browser
Species Human (GRCh38)
Location X:43136684-43136706
Sequence TTTCCTATGGGGAATATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189646333_1189646341 27 Left 1189646333 X:43136684-43136706 CCCATTATATTCCCCATAGGAAA No data
Right 1189646341 X:43136734-43136756 CTGATTACTTACTAAGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189646333 Original CRISPR TTTCCTATGGGGAATATAAT GGG (reversed) Intergenic
No off target data available for this crispr