ID: 1189661541

View in Genome Browser
Species Human (GRCh38)
Location X:43305320-43305342
Sequence TTTTTGGTATATAACTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189661541_1189661544 21 Left 1189661541 X:43305320-43305342 CCTTCCAAGTTATATACCAAAAA No data
Right 1189661544 X:43305364-43305386 AATTTATTGTAATAATCTATCGG No data
1189661541_1189661545 25 Left 1189661541 X:43305320-43305342 CCTTCCAAGTTATATACCAAAAA No data
Right 1189661545 X:43305368-43305390 TATTGTAATAATCTATCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189661541 Original CRISPR TTTTTGGTATATAACTTGGA AGG (reversed) Intergenic
No off target data available for this crispr