ID: 1189664623

View in Genome Browser
Species Human (GRCh38)
Location X:43340546-43340568
Sequence ATGCCTATCCAGAAGGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189664623_1189664627 8 Left 1189664623 X:43340546-43340568 CCTTCACCCTTCTGGATAGGCAT No data
Right 1189664627 X:43340577-43340599 GGATCTTTTGTTCCATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189664623 Original CRISPR ATGCCTATCCAGAAGGGTGA AGG (reversed) Intergenic
No off target data available for this crispr