ID: 1189664627

View in Genome Browser
Species Human (GRCh38)
Location X:43340577-43340599
Sequence GGATCTTTTGTTCCATGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189664625_1189664627 1 Left 1189664625 X:43340553-43340575 CCTTCTGGATAGGCATCATGTAT No data
Right 1189664627 X:43340577-43340599 GGATCTTTTGTTCCATGATTTGG No data
1189664623_1189664627 8 Left 1189664623 X:43340546-43340568 CCTTCACCCTTCTGGATAGGCAT No data
Right 1189664627 X:43340577-43340599 GGATCTTTTGTTCCATGATTTGG No data
1189664624_1189664627 2 Left 1189664624 X:43340552-43340574 CCCTTCTGGATAGGCATCATGTA No data
Right 1189664627 X:43340577-43340599 GGATCTTTTGTTCCATGATTTGG No data
1189664620_1189664627 16 Left 1189664620 X:43340538-43340560 CCAGGAGGCCTTCACCCTTCTGG No data
Right 1189664627 X:43340577-43340599 GGATCTTTTGTTCCATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189664627 Original CRISPR GGATCTTTTGTTCCATGATT TGG Intergenic
No off target data available for this crispr