ID: 1189665963

View in Genome Browser
Species Human (GRCh38)
Location X:43355081-43355103
Sequence CCTGATCTCCTGTAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189665963_1189665968 -10 Left 1189665963 X:43355081-43355103 CCCTGCAGCTACAGGAGATCAGG No data
Right 1189665968 X:43355094-43355116 GGAGATCAGGTTCTCCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189665963 Original CRISPR CCTGATCTCCTGTAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr