ID: 1189671857

View in Genome Browser
Species Human (GRCh38)
Location X:43419427-43419449
Sequence TTGTGGGTATGTTGGCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189671857_1189671864 16 Left 1189671857 X:43419427-43419449 CCCATTTGCCAACATACCCACAA No data
Right 1189671864 X:43419466-43419488 TGTGTTTTCTAGAGCAAGAAAGG No data
1189671857_1189671865 17 Left 1189671857 X:43419427-43419449 CCCATTTGCCAACATACCCACAA No data
Right 1189671865 X:43419467-43419489 GTGTTTTCTAGAGCAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189671857 Original CRISPR TTGTGGGTATGTTGGCAAAT GGG (reversed) Intergenic
No off target data available for this crispr