ID: 1189671857 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:43419427-43419449 |
| Sequence | TTGTGGGTATGTTGGCAAAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1189671857_1189671864 | 16 | Left | 1189671857 | X:43419427-43419449 | CCCATTTGCCAACATACCCACAA | No data | ||
| Right | 1189671864 | X:43419466-43419488 | TGTGTTTTCTAGAGCAAGAAAGG | No data | ||||
| 1189671857_1189671865 | 17 | Left | 1189671857 | X:43419427-43419449 | CCCATTTGCCAACATACCCACAA | No data | ||
| Right | 1189671865 | X:43419467-43419489 | GTGTTTTCTAGAGCAAGAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1189671857 | Original CRISPR | TTGTGGGTATGTTGGCAAAT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||