ID: 1189672334

View in Genome Browser
Species Human (GRCh38)
Location X:43424357-43424379
Sequence CTGTGGGTCAGGGGTTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189672334_1189672340 24 Left 1189672334 X:43424357-43424379 CCATATGAACCCCTGACCCACAG No data
Right 1189672340 X:43424404-43424426 TTGCTTAACATCACTTAGTTTGG No data
1189672334_1189672341 25 Left 1189672334 X:43424357-43424379 CCATATGAACCCCTGACCCACAG No data
Right 1189672341 X:43424405-43424427 TGCTTAACATCACTTAGTTTGGG No data
1189672334_1189672342 26 Left 1189672334 X:43424357-43424379 CCATATGAACCCCTGACCCACAG No data
Right 1189672342 X:43424406-43424428 GCTTAACATCACTTAGTTTGGGG No data
1189672334_1189672343 29 Left 1189672334 X:43424357-43424379 CCATATGAACCCCTGACCCACAG No data
Right 1189672343 X:43424409-43424431 TAACATCACTTAGTTTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189672334 Original CRISPR CTGTGGGTCAGGGGTTCATA TGG (reversed) Intergenic
No off target data available for this crispr