ID: 1189682500

View in Genome Browser
Species Human (GRCh38)
Location X:43531360-43531382
Sequence GGACTGAGAGCAGGACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189682500_1189682504 2 Left 1189682500 X:43531360-43531382 CCCACTTGTCCTGCTCTCAGTCC No data
Right 1189682504 X:43531385-43531407 CTCCAACCCATTCTGCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189682500 Original CRISPR GGACTGAGAGCAGGACAAGT GGG (reversed) Intergenic
No off target data available for this crispr