ID: 1189683292

View in Genome Browser
Species Human (GRCh38)
Location X:43538329-43538351
Sequence TGTTATGTATGATCACAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189683289_1189683292 28 Left 1189683289 X:43538278-43538300 CCTCTTGAGTGAAGGATGGGCAA No data
Right 1189683292 X:43538329-43538351 TGTTATGTATGATCACAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189683292 Original CRISPR TGTTATGTATGATCACAATA AGG Intergenic
No off target data available for this crispr