ID: 1189684160

View in Genome Browser
Species Human (GRCh38)
Location X:43546380-43546402
Sequence GCGTGGTGGCATGTGTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189684160_1189684163 9 Left 1189684160 X:43546380-43546402 CCTACAGACACATGCCACCACGC No data
Right 1189684163 X:43546412-43546434 TTTTGTATTTTTTGTAGAGATGG 0: 6493
1: 211270
2: 146912
3: 70533
4: 147369
1189684160_1189684164 10 Left 1189684160 X:43546380-43546402 CCTACAGACACATGCCACCACGC No data
Right 1189684164 X:43546413-43546435 TTTGTATTTTTTGTAGAGATGGG 0: 4530
1: 102448
2: 256591
3: 163839
4: 90505
1189684160_1189684166 30 Left 1189684160 X:43546380-43546402 CCTACAGACACATGCCACCACGC No data
Right 1189684166 X:43546433-43546455 GGGGTTTCATCATGTTGTTCAGG 0: 19
1: 1141
2: 22856
3: 125418
4: 193265
1189684160_1189684165 11 Left 1189684160 X:43546380-43546402 CCTACAGACACATGCCACCACGC No data
Right 1189684165 X:43546414-43546436 TTGTATTTTTTGTAGAGATGGGG 0: 4126
1: 94416
2: 185410
3: 185009
4: 121101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189684160 Original CRISPR GCGTGGTGGCATGTGTCTGT AGG (reversed) Intergenic
No off target data available for this crispr