ID: 1189684395

View in Genome Browser
Species Human (GRCh38)
Location X:43548808-43548830
Sequence AAGAAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189684390_1189684395 8 Left 1189684390 X:43548777-43548799 CCATCTGAAGAAGAAGAAGAAGA No data
Right 1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG No data
1189684389_1189684395 30 Left 1189684389 X:43548755-43548777 CCTGGGAGACAAGAGTGAAACTC 0: 122
1: 3164
2: 17909
3: 29020
4: 31844
Right 1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189684395 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG Intergenic
No off target data available for this crispr