ID: 1189689897

View in Genome Browser
Species Human (GRCh38)
Location X:43605081-43605103
Sequence CACAGCTGACACCTTGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189689893_1189689897 4 Left 1189689893 X:43605054-43605076 CCAGTAGAGCCTTGAGATGACTG No data
Right 1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG No data
1189689895_1189689897 -5 Left 1189689895 X:43605063-43605085 CCTTGAGATGACTGTGGCCACAG No data
Right 1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG No data
1189689892_1189689897 7 Left 1189689892 X:43605051-43605073 CCTCCAGTAGAGCCTTGAGATGA No data
Right 1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189689897 Original CRISPR CACAGCTGACACCTTGATTG AGG Intergenic
No off target data available for this crispr