ID: 1189700462

View in Genome Browser
Species Human (GRCh38)
Location X:43713496-43713518
Sequence CTAGTATTCCACATCTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189700462 Original CRISPR CTAGTATTCCACATCTATAT GGG (reversed) Intronic
900588524 1:3446179-3446201 CTAATATTCCTCATGGATATAGG - Intergenic
900949636 1:5851151-5851173 TTTGTATTCCACATCTAATTAGG + Intergenic
901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG + Intronic
905921481 1:41722336-41722358 CTAGTTTTCCACATATATCAGGG + Intronic
909944435 1:81648005-81648027 CTAGTGACCCACATCTAAATAGG - Intronic
911651212 1:100391053-100391075 CTTGAATTCCACAGTTATATAGG + Intronic
913105146 1:115607467-115607489 CTCTTAACCCACATCTATATTGG + Intergenic
917627065 1:176856972-176856994 TGAGTATTCCACACCTATTTTGG + Intergenic
917644361 1:177015575-177015597 CTACAATTCCACATTTATTTAGG + Intronic
918117966 1:181512881-181512903 ATAGTATTACAGAACTATATTGG + Intronic
924503714 1:244660928-244660950 CTATTATTCCAAAGCTTTATTGG + Intronic
924743265 1:246810108-246810130 CTATTATTGAGCATCTATATAGG - Intergenic
1063808650 10:9678310-9678332 CAAGAATTCTACATTTATATTGG + Intergenic
1063957185 10:11278054-11278076 CTAAAATGCCACATTTATATGGG + Intronic
1065272371 10:24048204-24048226 CATGTATTACATATCTATATGGG + Intronic
1065508163 10:26450620-26450642 CTAGTTTTCCACAGCCATAGTGG - Intronic
1065695416 10:28375309-28375331 ATATTATTGCACATCTAGATGGG - Intergenic
1066417840 10:35237790-35237812 CTAGTATCCCACACATTTATGGG + Intergenic
1073842824 10:107517597-107517619 AAAGAATTCCACATCTATAAAGG + Intergenic
1088076232 11:105851931-105851953 CTACTGTTCCATTTCTATATCGG + Intronic
1088334491 11:108688608-108688630 TTAGTATTCCACATCTCATTAGG - Intronic
1090527201 11:127549597-127549619 CTAGTTTTCCACATTTTTATTGG - Intergenic
1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG + Intronic
1093033657 12:14312662-14312684 CAAATATTCCACATTTATAAAGG - Intergenic
1094344842 12:29456042-29456064 CTAGTATTCCAATTTTATTTTGG + Intronic
1097293468 12:57940072-57940094 ATAGTATTTCAAATGTATATAGG + Intergenic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1099871188 12:88351293-88351315 CTTGTATTTTACATCTCTATTGG + Intergenic
1108861224 13:54861796-54861818 CTAGCATTCAACATCAATAAGGG - Intergenic
1108961310 13:56235228-56235250 CATGTATTTCACATCTTTATAGG - Intergenic
1109004314 13:56851768-56851790 CTACTAATCAACATCTACATAGG + Intergenic
1113420653 13:110169430-110169452 CCAGTAACCCACATCTTTATTGG - Intronic
1116794631 14:49376509-49376531 CTTCTATTCCACTTGTATATGGG + Intergenic
1122368305 14:101211904-101211926 CCAGTAGTTCACATCTTTATAGG + Intergenic
1126676126 15:51160570-51160592 CTAGAATTCCACATTTACAGTGG + Intergenic
1127474603 15:59321658-59321680 CTAGTAGTCCCCATGTCTATTGG - Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1131571949 15:93546795-93546817 CTATTATTCCTCTTCTGTATGGG - Intergenic
1135238810 16:20784296-20784318 CTAGTGTTCAATATCCATATAGG + Intronic
1135387088 16:22051995-22052017 AAATTATTCCACATATATATAGG - Intronic
1138953078 16:61937677-61937699 CTAGTATCACATATCTATAAAGG + Intronic
1144297680 17:13893492-13893514 CTAGTCTTTCACATCTTTGTTGG - Intergenic
1151112867 17:71700163-71700185 CTAGTACTCCATTTTTATATGGG + Intergenic
1154428511 18:14290565-14290587 CTACAATTCCACATGAATATTGG - Intergenic
1154430791 18:14306988-14307010 CTACAATTCCACATGAATATTGG - Intergenic
1155575023 18:27235087-27235109 CAAGTATTTCACATCTCTAAGGG - Intergenic
1159160562 18:64638831-64638853 CTAGTATTTAATATCCATATGGG - Intergenic
1168437040 19:56326545-56326567 TTAATATTCCACATATAAATGGG + Intronic
925550981 2:5074135-5074157 TTAGTATTCCCCATCTTCATAGG - Intergenic
928937146 2:36690549-36690571 CTACTATTCAACATCTCTAGAGG - Intergenic
931151356 2:59577385-59577407 CTTTTATTCCACATGTATTTAGG - Intergenic
931494725 2:62790970-62790992 CCAGAAACCCACATCTATATTGG - Intronic
931582409 2:63791357-63791379 TTAGTATTCCAATTCTTTATGGG + Intronic
933612722 2:84453994-84454016 CTGTTATTCCACTTCTAGATGGG - Intronic
935745925 2:106190279-106190301 AGATTATACCACATCTATATAGG + Intronic
936804925 2:116319530-116319552 CTAGAATTCCACATGGACATAGG + Intergenic
939009678 2:136831405-136831427 CTGCTATTCAACAGCTATATGGG - Intronic
941461769 2:165780434-165780456 CTAGAAATACAGATCTATATTGG - Intronic
943972678 2:194431173-194431195 ATTATATTCCACATTTATATAGG - Intergenic
945009046 2:205442233-205442255 CTAGAATTCCCCATATGTATTGG - Intronic
945078278 2:206062657-206062679 CCAGAATTCAACATTTATATAGG + Intronic
1169630874 20:7629856-7629878 CTAATATTTCACAATTATATAGG + Intergenic
1169900298 20:10545849-10545871 CTAGTAATCAACATCTAGGTTGG - Intronic
1174948120 20:55011287-55011309 CTAGTATTCTACATGGCTATAGG + Intergenic
1176843585 21:13859538-13859560 CTAAAATTCCACATGAATATTGG + Intergenic
1182851119 22:33475168-33475190 CCAGTATTCATCTTCTATATGGG - Intronic
959799798 3:110479246-110479268 ATAGTGTTCTACATCTAGATGGG + Intergenic
960322544 3:116254093-116254115 AGAGTATTCCACATATATTTAGG - Intronic
961161211 3:124727957-124727979 CTAATATTCCATAACTATATTGG - Intergenic
962152573 3:132908372-132908394 GAAGTGTTCCACATCTTTATTGG - Intergenic
963617524 3:147560610-147560632 CTATCATTCCACATATATTTAGG + Intergenic
965866130 3:173206048-173206070 CTAGCATTCCAAATTTGTATTGG - Intergenic
969950543 4:10831057-10831079 TTAGAATTCCACATTTATCTGGG - Intergenic
976998824 4:91469099-91469121 CTAATATACCAAATCTACATTGG + Intronic
978752402 4:112265294-112265316 CTATTGTATCACATCTATATGGG - Intronic
979431228 4:120634079-120634101 CCAGAAATCCACATGTATATAGG + Intergenic
980262586 4:130471497-130471519 TAAGTATTCCATTTCTATATCGG - Intergenic
980463073 4:133143191-133143213 TTGGTATTCTCCATCTATATAGG - Intergenic
981088231 4:140705640-140705662 CTAGTATTCTACATCAATAGAGG - Intronic
982369179 4:154615199-154615221 CAAGTATTCCACTTCTAAAATGG - Intergenic
986421124 5:7584096-7584118 GTAATGTTCCACATCTTTATAGG + Intronic
987860414 5:23479571-23479593 CTTGTATTTCACTTCTACATTGG + Intergenic
988436901 5:31186800-31186822 CTATTATTCCAAATCCATAATGG + Intergenic
997125302 5:131220599-131220621 CTTGTTTTCTACATCTATAATGG - Intergenic
1000501659 5:162058844-162058866 GTAATATTCCACATTTTTATAGG - Intergenic
1000514249 5:162220268-162220290 CTTGTCTTCCTCATCTATAGGGG - Intergenic
1004813455 6:19286509-19286531 CTAGTATTGGTCATTTATATTGG - Intergenic
1006936554 6:37722858-37722880 CTAGTACTCCACATCCATGTCGG + Intergenic
1011561522 6:88622235-88622257 CAAGTATTAAACACCTATATAGG + Intronic
1013702253 6:112786890-112786912 CTAGGATTCCATATCTGTTTTGG + Intergenic
1013916959 6:115352157-115352179 CTTTTATTCCACATCTTTATGGG - Intergenic
1015712163 6:136154018-136154040 CTAGTATACCACTCCTATTTGGG + Intronic
1017288018 6:152700992-152701014 GTATTATTCCACAACTATATAGG - Intronic
1018538355 6:164848619-164848641 CTTGCATTACACATTTATATTGG + Intergenic
1020560450 7:9724910-9724932 TTAGTTTTCCACATCCATTTTGG - Intergenic
1024681535 7:51694500-51694522 CTTGTTTTCAGCATCTATATGGG + Intergenic
1032899030 7:136285415-136285437 TTATTATCCTACATCTATATTGG - Intergenic
1040977486 8:53210171-53210193 CTATTATGACACATGTATATTGG - Intergenic
1045174137 8:99702864-99702886 CTAGCATTACAAATCTATTTCGG - Intronic
1045793378 8:106013064-106013086 CTAGATTTCCACATCTAGTTAGG - Intergenic
1048225461 8:132580993-132581015 CCAGGAGTCCACATCTGTATGGG - Intronic
1048526043 8:135203764-135203786 CTAATATTCCGAATCTATAAGGG + Intergenic
1051815908 9:21105322-21105344 CTGGTTTTCCACATATATAGTGG - Intergenic
1055864277 9:80794099-80794121 CTAGTACTCCTCCTATATATAGG - Intergenic
1062045961 9:134424668-134424690 CCAGTGTTCCACATCTGAATTGG - Intronic
1185926047 X:4148011-4148033 CTAGTAATCCACTATTATATTGG + Intergenic
1186545542 X:10445301-10445323 CTGGGTTTCCACTTCTATATAGG + Exonic
1186792021 X:13008834-13008856 CTAGGGTTCCACAGCTATGTAGG + Intergenic
1187190493 X:17030487-17030509 CTAGCAGCCCACATCTTTATGGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1192291702 X:69803727-69803749 CTAGTATTCTACACCAATGTAGG - Intronic
1193670521 X:84379223-84379245 ATAATATTTCAGATCTATATGGG - Intronic
1196335707 X:114530771-114530793 TAAATATTCCACATATATATCGG - Intergenic
1199773785 X:150993238-150993260 CTAGTATTCAAAATATATAAAGG + Intergenic