ID: 1189701148

View in Genome Browser
Species Human (GRCh38)
Location X:43717022-43717044
Sequence GTGGTTAAGGTGAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 422}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189701140_1189701148 13 Left 1189701140 X:43716986-43717008 CCAACAATGACACAGAAGGATGG 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG 0: 1
1: 0
2: 1
3: 32
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189701148 Original CRISPR GTGGTTAAGGTGAGGCAGGA TGG Intronic
900977733 1:6027495-6027517 GTGGTCACTGAGAGGCAGGATGG + Intronic
902020643 1:13342828-13342850 GTGGCTCAGGCCAGGCAGGATGG + Exonic
902208453 1:14887159-14887181 GCAGTTAAGGGGAAGCAGGAAGG - Intronic
902583023 1:17421095-17421117 GTGGTCTAGGTGATGAAGGAAGG - Intronic
902618119 1:17634917-17634939 GTGGTGGAGGTGGGCCAGGACGG + Exonic
902648089 1:17817987-17818009 GTGGTTGAGGTCAGGCACGGTGG - Intronic
903173126 1:21565725-21565747 GTGGTGACGGAGAGGCAGGTGGG - Intronic
903262361 1:22138304-22138326 GTGGTTGTGGTGAGGCATGGAGG + Intronic
903329922 1:22592131-22592153 GTGGTGATGGTGAGGCAGGAGGG - Intronic
903376620 1:22870452-22870474 GTGGGTGTGGAGAGGCAGGAGGG - Intronic
903480456 1:23649445-23649467 GAGGTTACGGTGAGCCAAGATGG - Intergenic
903499841 1:23794892-23794914 GTGGCTAAGGCCAGGAAGGAAGG - Exonic
903536639 1:24071310-24071332 GTGCTCAAGGTGGGGCTGGAAGG - Intronic
904498084 1:30898688-30898710 GTGGGGAAGGGCAGGCAGGACGG - Intronic
904644799 1:31957676-31957698 GTGGTCAGGGTGAGGCATGGTGG - Intergenic
904810028 1:33157461-33157483 CTGGGAAAGGTGAGACAGGATGG - Intronic
904988792 1:34574489-34574511 GTGGTTAGAGGGAGGGAGGATGG - Intergenic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905121917 1:35688901-35688923 GTGGCCCAGGTGAGGCTGGATGG + Intergenic
906281154 1:44554776-44554798 GTGGTGAAGGTGAGCTGGGAGGG - Intronic
906790196 1:48652478-48652500 GAGGAGGAGGTGAGGCAGGATGG + Intronic
907204152 1:52754088-52754110 GAGGTTGCAGTGAGGCAGGATGG - Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG + Intergenic
907578885 1:55554234-55554256 GTGGGTGAGGAGAGGCAGGTTGG + Intergenic
907753602 1:57287858-57287880 GAGGTTACGGTGAGCCAAGATGG - Intronic
908177139 1:61566722-61566744 GTGTTGAAGGTGGGGCAGGTGGG - Intergenic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
909068025 1:70959941-70959963 TTAGTTAAGATGAGGTAGGATGG + Intronic
910274272 1:85431553-85431575 GGGGTAGAGGTGAGGAAGGAGGG - Intronic
910795862 1:91096952-91096974 GGGGTTGTGGTGAGCCAGGATGG - Intergenic
911351032 1:96755824-96755846 GTGGGAAAGGACAGGCAGGAGGG + Intronic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
912058273 1:105632357-105632379 GTGGGTAAGGTGGGGAGGGAAGG - Intergenic
912671580 1:111632854-111632876 GAGGTTGTGGTGAGCCAGGATGG + Intronic
913027928 1:114864551-114864573 GGGGTTATGGTGAGCCAAGATGG - Intronic
913303529 1:117398978-117399000 GTAGTTTAGGTGAGGCATGATGG + Intronic
913446939 1:118960134-118960156 GTGGTTTGAGTGAGGCGGGATGG + Intronic
913594815 1:120365134-120365156 GAGGTTAGGGTGAGAAAGGATGG - Intergenic
914092453 1:144513852-144513874 GAGGTTAGGGTGAGAAAGGATGG + Intergenic
914306078 1:146420019-146420041 GAGGTTAGGGTGAGAAAGGATGG - Intergenic
914595974 1:149152790-149152812 GAGGTTAGGGTGAGAAAGGATGG + Intergenic
916241262 1:162642335-162642357 GAGGTTGTGGTGAGCCAGGATGG - Intronic
916414366 1:164578841-164578863 GTGCTTGAGGAAAGGCAGGAAGG - Intronic
917489859 1:175488846-175488868 GTGGAATAGGTGAGGGAGGAAGG + Intronic
917521573 1:175752162-175752184 GGGGTGAGGGTGAGGCAAGAAGG + Intergenic
918924322 1:190761495-190761517 GTAGTGAAGGTGAGGGAGGATGG + Intergenic
919672666 1:200351928-200351950 GAGGTTACTGTGAAGCAGGAAGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
921798933 1:219379931-219379953 GTGGTGAAGAAGAGGCAGGAAGG + Intergenic
922079074 1:222277063-222277085 GTGGGGATGCTGAGGCAGGAGGG + Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922888931 1:229045768-229045790 GGGGTTAAGAGGAGGCAGAATGG + Intergenic
924227682 1:241935506-241935528 GAGGTTGAGGTGAGCCAAGATGG - Intergenic
924443107 1:244103104-244103126 CAGGTTGAGGTGAGTCAGGAAGG + Intergenic
1063702586 10:8400110-8400132 GTGTGTGAAGTGAGGCAGGAAGG + Intergenic
1067368450 10:45659154-45659176 GTAGTTTAGGTGAGGTAGGGAGG - Intronic
1069617135 10:69813462-69813484 GTGGTTCTGGTGAGACAGGGAGG + Intronic
1069822493 10:71236353-71236375 ATGTTTTAGGTGAGGCAGGGCGG - Intronic
1069853661 10:71426488-71426510 GGACTTCAGGTGAGGCAGGAGGG + Intronic
1070799225 10:79235288-79235310 GTGGTGAAAGGAAGGCAGGAAGG + Intronic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1073045906 10:100638032-100638054 GGGGACAATGTGAGGCAGGAGGG + Intergenic
1073811987 10:107162448-107162470 ATGGTTAAGGTAAGGAATGAGGG + Intronic
1075576425 10:123580877-123580899 GTGGCCCAGGTGAGGCTGGAGGG - Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1076251701 10:128989398-128989420 GTGATTAAGGTCAGTCAGGATGG - Intergenic
1076276398 10:129202952-129202974 GTGATTAAGCTGAGTAAGGAAGG - Intergenic
1077176456 11:1193338-1193360 GTGCTGAGGGTGGGGCAGGAAGG + Intronic
1077949973 11:6946168-6946190 GTGGTTCAGGTGAGAGATGATGG - Intronic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078471661 11:11592510-11592532 GGGGGTAAGGTGAGGGAGCATGG - Intronic
1078881654 11:15455854-15455876 GTGTTTCTGGTGAGGCAGGATGG + Intergenic
1079105982 11:17572740-17572762 GTGTATGAGGTGAGGCAGGAGGG - Intronic
1080247524 11:30196353-30196375 GTGGTCAAGGAAAGGAAGGAAGG + Intergenic
1080303399 11:30810559-30810581 GTGGTTGAGTTGAGGAAGGAAGG - Intergenic
1081125939 11:39321222-39321244 CAGGTTAAGTTGATGCAGGAAGG - Intergenic
1081741942 11:45447047-45447069 GTGGTGGAGGTGAGGCGGGCAGG + Intergenic
1082039628 11:47674190-47674212 GGGGATAAGGAGTGGCAGGAGGG + Intronic
1082814554 11:57499554-57499576 GTGGGTAAGGCGAGGCCGGCCGG + Intronic
1083199956 11:61114944-61114966 GTGGATAGGGGGAGGCAGAAAGG + Intronic
1083763865 11:64832980-64833002 GTGGATGAGGTGAGGCTGGGAGG + Intronic
1083790377 11:64980909-64980931 GTGGTGAAAGGGAGGAAGGAAGG - Intergenic
1085014215 11:73162300-73162322 GTGGTTAACTGGAGGCAAGAAGG + Intergenic
1085285122 11:75354619-75354641 GTGGTACAGGTGAGGCAGCAGGG + Intergenic
1085912027 11:80838404-80838426 GTGGATGAGGTGAGAGAGGAAGG + Intergenic
1086001165 11:81987228-81987250 GAAGTTAAGAAGAGGCAGGAAGG - Intergenic
1086274241 11:85106081-85106103 GTGGGTAATGTGAGGCAGTCTGG + Intronic
1086846444 11:91755582-91755604 CTAGTTAAGGTGATGCTGGAGGG - Intergenic
1087128414 11:94648161-94648183 GTGGTGTTGGTGAGGGAGGAGGG + Intergenic
1087212870 11:95461310-95461332 GGGGATAAGGTGGGGCAGGCAGG + Intergenic
1088949340 11:114550991-114551013 GTAGTTGAGGTGGGGGAGGAGGG + Intronic
1089429811 11:118413529-118413551 GAGATTAAGATGAGGCAGAAGGG - Intronic
1090731161 11:129574309-129574331 ATGGTTAAGGTGAGGTGGGCGGG + Intergenic
1091159873 11:133410401-133410423 GTGGTTGTTGGGAGGCAGGAGGG + Intronic
1093422332 12:18988669-18988691 GAGGCTGAGGTGAGGCAGGAGGG - Intergenic
1094571748 12:31647207-31647229 GAGGATAGGGTGAGGCAGGCTGG - Intronic
1094598205 12:31884618-31884640 GTGGTTGTGGTGAGCCAAGATGG + Intergenic
1095991348 12:48036806-48036828 GTGGTAGGGGTGAGGAAGGAGGG - Intergenic
1096978732 12:55716425-55716447 GGGGCTAAGGTGCGGCAGGTCGG - Intronic
1097779329 12:63685667-63685689 GAGGTGAAAGTGAGGCAAGAGGG - Intergenic
1097805981 12:63965561-63965583 TTTGTTAGGCTGAGGCAGGAGGG + Intronic
1098344451 12:69486608-69486630 GTGATTAAAGTTAGGGAGGAAGG + Intronic
1099244730 12:80180978-80181000 GTGGTTAAGGTGAGGCATATGGG + Intergenic
1100616641 12:96236186-96236208 GTGTTTAAGGAGAGCCAGGAGGG + Intronic
1101119248 12:101562115-101562137 GTTTTTCAGGTGAGGCTGGAGGG - Intergenic
1101509394 12:105379390-105379412 GTGTTTAAGCTGAGGAAGGAGGG - Intronic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102995072 12:117342846-117342868 GTGGTGAAAGGGAGGAAGGAAGG + Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104598981 12:130139636-130139658 CTGGGTTAAGTGAGGCAGGAGGG - Intergenic
1104789201 12:131471374-131471396 GTGGTGCAGGGGAGGCAGGACGG + Intergenic
1104852774 12:131885484-131885506 GTGGCTAATGTTAGGCAAGAAGG + Intergenic
1106314325 13:28579700-28579722 GATGTTAAGGAGAGGAAGGAGGG - Intergenic
1111086779 13:83386058-83386080 GAGGTGAATGTGAGGCATGAAGG - Intergenic
1112698486 13:101977212-101977234 CTGGTTAAGTTTAGGGAGGAGGG - Intronic
1113097178 13:106678320-106678342 CTGATGAAGATGAGGCAGGATGG + Intergenic
1113516161 13:110901684-110901706 GTTGTTAAGGTGTTTCAGGATGG - Intronic
1113692371 13:112320325-112320347 GTGGGTGAGTTGAGGCTGGAGGG - Intergenic
1116825824 14:49672562-49672584 GAGGTTATGGTGAGCCAAGATGG - Intronic
1116882412 14:50184797-50184819 GAGGTTATGGTGAGCCAAGATGG + Intronic
1120004937 14:79346012-79346034 GTGGTTTAGGTGAGAAACGATGG - Intronic
1121259659 14:92557033-92557055 GTGGTTACGGGGCTGCAGGAGGG - Intronic
1122214557 14:100194225-100194247 GTGGTGGAGGTGGGGCTGGATGG - Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122650340 14:103222541-103222563 GAGGCTGAGGTGGGGCAGGAGGG + Intergenic
1122826822 14:104374610-104374632 GTGGGTATGGGGAGGCCGGAGGG + Intergenic
1126002405 15:44223357-44223379 GAGGTTGCGGTGAGCCAGGATGG + Intergenic
1127279883 15:57479774-57479796 GAGGTACAGGGGAGGCAGGAAGG + Intronic
1127806512 15:62525989-62526011 ATGGTGCAGGTGGGGCAGGAAGG + Intronic
1128037864 15:64542342-64542364 GTAGTTAATGTGAGGGAGAAAGG + Intronic
1128156280 15:65393926-65393948 GAGGGAAAGGTGAGGAAGGAGGG - Intronic
1129011752 15:72424855-72424877 GTGGCAAAGATGAGGCTGGAAGG + Intergenic
1129079102 15:73023846-73023868 GCAGTTGAGGTTAGGCAGGAAGG + Intergenic
1129421994 15:75435631-75435653 GAGGTTGAGGTGAGCCAAGATGG + Intronic
1129538949 15:76335969-76335991 GTGGTGGAGGAGAGGGAGGAGGG + Intergenic
1130404717 15:83588177-83588199 GAGGTTACGGTGAGCCAAGATGG - Intronic
1130575571 15:85090187-85090209 GTTGTTCAGCTGAAGCAGGATGG - Intronic
1130971868 15:88739950-88739972 GTGGAGAAGGTGAGGCATAATGG + Intergenic
1131019483 15:89086520-89086542 GTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1131492858 15:92877985-92878007 ATATTTAAGTTGAGGCAGGAAGG - Intergenic
1132543147 16:520828-520850 GAGGTCAAGTAGAGGCAGGAAGG + Exonic
1132665475 16:1079541-1079563 GTGGTGAAGGTGAGGGCGGCGGG + Exonic
1132911949 16:2318307-2318329 GTGGGGCAGGTGAGGAAGGAAGG - Intronic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133061698 16:3179049-3179071 GAGGTTGTGGTGAGCCAGGAAGG + Intergenic
1133116076 16:3578718-3578740 GTGGCTCAGGGGAGGTAGGAGGG + Intergenic
1133521188 16:6558911-6558933 AAGGTTGTGGTGAGGCAGGAGGG - Intronic
1134476368 16:14577574-14577596 TTTGTGAAGGTGAGGAAGGAGGG - Intronic
1134687557 16:16169481-16169503 GTCCTTAAGATGAGGCTGGAGGG - Intronic
1136356331 16:29746666-29746688 GTGGATAAGACAAGGCAGGATGG - Intergenic
1137379419 16:47983653-47983675 GTGATTAAGGGAAGGAAGGAAGG - Intergenic
1137396549 16:48119564-48119586 GAGGCTCAGGTGTGGCAGGAAGG - Intronic
1137893453 16:52185876-52185898 GTGGGTATCATGAGGCAGGATGG + Intergenic
1137908450 16:52350922-52350944 GTGGTCAAGGGAAGGCAGAATGG - Intergenic
1137955413 16:52824492-52824514 GAGGGGAAGGTGAGGAAGGAAGG - Intergenic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1138511046 16:57508551-57508573 GTGTTAGAGGGGAGGCAGGAGGG - Intergenic
1138726011 16:59139986-59140008 GTGATGGAGGTGAGGCATGAGGG - Intergenic
1139586941 16:67909951-67909973 GTGGGAAAAGTGAGGCAGGAAGG + Intronic
1139647548 16:68342520-68342542 GGGGTTAAGGCCAGGCAGGCTGG - Intronic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1141662689 16:85449919-85449941 GTGGGCATGGTGTGGCAGGAAGG - Intergenic
1141726364 16:85791797-85791819 TTTGTAAAGGGGAGGCAGGAAGG - Intronic
1142112931 16:88341742-88341764 GGGGTTCAGATGAGCCAGGAAGG + Intergenic
1142300318 16:89254015-89254037 GTGGTTACGATGAGCCATGATGG + Intergenic
1142547815 17:717196-717218 GTGGATGGGGTGAGGCAAGAGGG - Intronic
1142566573 17:844105-844127 CCAGTTAAGGAGAGGCAGGACGG - Intronic
1142566597 17:844204-844226 CCAGTTAAGGAGAGGCAGGATGG - Intronic
1142633112 17:1238966-1238988 GAGGTTGCGGTGAGCCAGGATGG - Intergenic
1142701866 17:1667401-1667423 GGGGATAAGGGGAGGCAAGAAGG + Intronic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1144020697 17:11238870-11238892 GTGGTTAAGGTGTGTGAGCAGGG - Intergenic
1144273535 17:13643179-13643201 GGGGTTAAGGTGAAGGGGGAGGG - Intergenic
1144755671 17:17679195-17679217 CAGGTTAAGGTAAGGCAGGGAGG + Intergenic
1144773533 17:17772404-17772426 GTGGCTGCAGTGAGGCAGGATGG - Intronic
1145035145 17:19535368-19535390 GAGGTTACAGTGAGCCAGGATGG + Intronic
1145398061 17:22511733-22511755 GTGGGTGGGGTGGGGCAGGAGGG - Intergenic
1148012940 17:44499403-44499425 GAGGTTGAGGTGAGCCAAGATGG + Intronic
1148548100 17:48532069-48532091 GTGGTGAAGGAGAGACAGGTAGG - Intergenic
1148698136 17:49573323-49573345 GTTGCTGTGGTGAGGCAGGAAGG - Intergenic
1148777303 17:50102778-50102800 GAGGTGAAAGTGGGGCAGGAGGG + Intronic
1149330779 17:55578874-55578896 GAGGTTACGGTGAGCCAAGATGG - Intergenic
1149430449 17:56593135-56593157 GTGCTTGAGGTGGGGCTGGAGGG - Intergenic
1149531045 17:57395543-57395565 GTTGTGAGGGTGAGGGAGGATGG + Intronic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1149980660 17:61308634-61308656 GTAGTTAAGGGAAGGCAGGAGGG + Intronic
1150035893 17:61796898-61796920 TTGGATGAGGTGAGGCAGTAAGG + Intronic
1150051858 17:61971867-61971889 GAGGTTACGGTGAGCCAAGACGG + Intronic
1150218391 17:63482712-63482734 GGGGTTTAGGTGAGGCTGGGTGG - Intergenic
1150335810 17:64330022-64330044 GAGGTTACGGTGAGCCAAGATGG - Intronic
1150375531 17:64678453-64678475 GTGGGTAAGGTAAGGCCTGAGGG - Intergenic
1151310388 17:73289049-73289071 GAGGTTGAGGTGGGGCAGGAGGG - Intronic
1151818954 17:76486905-76486927 CTGCTCAAGGTGGGGCAGGAGGG - Intronic
1152001088 17:77645747-77645769 GTGGTTTAGATGGGGGAGGAGGG - Intergenic
1152718419 17:81910966-81910988 GTGGTTACGGAGAAGCAGGGAGG + Intronic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156077606 18:33300002-33300024 ATGTTTAAGGTGGGGCATGATGG + Intronic
1157264979 18:46210844-46210866 GAGGTTACAGTGAGCCAGGATGG + Intronic
1157886944 18:51377639-51377661 GAGGTTGCGGTGAGCCAGGATGG + Intergenic
1160892413 19:1386220-1386242 GTGGGTGAGGTGAGGCCCGATGG - Intronic
1161239454 19:3213932-3213954 GGGGCTAAGGTGAGGCCTGAGGG - Intergenic
1161623801 19:5313730-5313752 TTGGTTCCGCTGAGGCAGGAAGG - Intronic
1162542237 19:11304204-11304226 GTGGTTGAGGCCAGGCAGGGAGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1163683319 19:18696240-18696262 CTGGTCAGGGTGAGGCAGGGCGG + Intronic
1165276368 19:34755449-34755471 GTGGTCACTGTGAGGGAGGATGG + Intergenic
1165461309 19:35945714-35945736 ATGGTAGAGGTGAGGCAGGAGGG + Exonic
1166861840 19:45815781-45815803 GGGGTGAAGGTGGGGGAGGAGGG - Intronic
1167640065 19:50676448-50676470 GAGGTGAAGGTGAGCCAGGCAGG + Intronic
1168015612 19:53570595-53570617 GAGGTTGAGGTGAGCCAAGATGG - Intronic
1168146692 19:54423539-54423561 GTGGTTAGGGTGGGGCTGGCTGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168522032 19:57059162-57059184 GTAGAAAAGATGAGGCAGGAGGG - Intergenic
925603511 2:5634480-5634502 GAGGTTAGGGTGAGAAAGGATGG - Intergenic
926141761 2:10372255-10372277 GTGGCTAAGGTGGGGGACGAGGG + Intronic
926744192 2:16137212-16137234 CAGGCTGAGGTGAGGCAGGAGGG + Intergenic
927448052 2:23183186-23183208 ATGATTAAGTAGAGGCAGGAAGG - Intergenic
927954123 2:27196254-27196276 GAGGTTATGGTGAGCCAAGATGG + Intergenic
928197593 2:29226661-29226683 ATGTTTAAGTGGAGGCAGGATGG + Intronic
928199626 2:29239387-29239409 GTGCTTCAGGTGAGGGAGGGGGG + Intronic
928425780 2:31176709-31176731 GTGGTTAAGGTGAGACATATGGG - Intronic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930394852 2:50808800-50808822 GTGTTGAAAGTGAGGCAGTAGGG - Intronic
930956839 2:57213003-57213025 GTGGTTAAGATGACGAAAGATGG - Intergenic
931318224 2:61152147-61152169 GTGGTTTAGGAAATGCAGGACGG + Intronic
931503435 2:62897080-62897102 GTGGTTATGGTTAGGAAGCAGGG - Intronic
931550775 2:63443712-63443734 GTGGTTGAGGTGAGAGATGATGG + Intronic
934025493 2:87998729-87998751 GTGGTTGCGGTGAGCCAAGAAGG + Intergenic
936529759 2:113268059-113268081 GGGATTAGGGTGAAGCAGGAAGG - Intronic
937072727 2:119076412-119076434 GTGGGAAGGATGAGGCAGGAGGG + Intergenic
937400187 2:121575740-121575762 GTGGGTGAGGAGAGGCAGAAAGG + Intronic
938514898 2:131993450-131993472 ATGGATAAAGGGAGGCAGGAGGG + Intergenic
941676025 2:168344294-168344316 GAGGTTGTGGTGAGCCAGGATGG + Intergenic
942457104 2:176145819-176145841 GTGGTTAGGGAGAGGCTGGGTGG - Intergenic
942662791 2:178283958-178283980 GTGGTGAAGGTGAGGCCTGGTGG - Intronic
947455150 2:230247392-230247414 GTGTTTAAGTTGAGGGAGGTGGG - Intronic
947687199 2:232098416-232098438 GAGGTTAAAGTGAGCCAAGATGG - Intronic
948229807 2:236341664-236341686 GTGGTTTAGGTGCACCAGGAGGG + Intronic
948565612 2:238884363-238884385 GTGGCACAGGTGAGGCCGGAGGG + Intronic
948789322 2:240369302-240369324 GTGGGGCAGGTGAAGCAGGAAGG - Intergenic
1168764710 20:373773-373795 GGGCCTAAGGAGAGGCAGGAAGG - Intronic
1168999994 20:2161820-2161842 GTGGTCCAGGTCCGGCAGGATGG - Intronic
1169235370 20:3925997-3926019 GTGGTCCAGGTGAGAAAGGAAGG + Intronic
1169482292 20:5995461-5995483 GTGGCAAAGGTGGGGCAGGGAGG - Intronic
1169858381 20:10127383-10127405 GTGGTTAAGGCCAGGCATGGTGG + Intergenic
1170282885 20:14670881-14670903 GTGGTTAGTCTTAGGCAGGAAGG + Intronic
1170746056 20:19099937-19099959 GAGGTTAAGGTCAGGCAGCTTGG + Intergenic
1170929092 20:20752681-20752703 GTGGTTTGGGTGGGGAAGGAGGG - Intergenic
1171456380 20:25275039-25275061 CTGCTTAAGGGCAGGCAGGAGGG + Intronic
1172014314 20:31863869-31863891 GGGGATAAGGTGGGGGAGGAAGG - Intronic
1172679451 20:36701247-36701269 CTTTTTAAGGTCAGGCAGGATGG + Intronic
1173707865 20:45125649-45125671 GGGGTTAAGTGGAGGCAGGGAGG + Intergenic
1174570879 20:51500628-51500650 GTGGTGAGGGTGAGGGTGGAGGG - Intronic
1175483603 20:59328903-59328925 GGGGTGGAGGTGAGGCAGGGAGG - Intergenic
1175955176 20:62605418-62605440 GGGGTGTGGGTGAGGCAGGAGGG - Intergenic
1177721040 21:24907238-24907260 GAGGTTGCAGTGAGGCAGGATGG + Intergenic
1177976530 21:27858616-27858638 ATGGATAAAGGGAGGCAGGAGGG - Intergenic
1178315086 21:31560356-31560378 GAGGTCCAGGTGAGACAGGATGG - Intergenic
1179338101 21:40476596-40476618 GTGCTTAAGGTGAGGACAGAAGG + Intronic
1181386315 22:22548385-22548407 GTGGCTCAGGGAAGGCAGGAGGG + Exonic
1181466803 22:23114806-23114828 GTGGGTGAGGACAGGCAGGAGGG - Intronic
1182223537 22:28777572-28777594 GAGGTTAAAGTGAGTCAAGATGG - Intronic
1182301549 22:29340001-29340023 GCTGCTAGGGTGAGGCAGGAAGG - Intronic
1182560738 22:31156980-31157002 GAGGTTGAGGTGAGTCAAGATGG + Intergenic
1183002417 22:34872424-34872446 GTGTTCAAGGAGAGGCTGGATGG - Intergenic
1183933644 22:41249715-41249737 CTGCTCAAGGTGAGGCCGGAAGG - Exonic
1184003718 22:41693892-41693914 GTGGTTAAGGTCATGGAGGTGGG - Exonic
1184137931 22:42560388-42560410 GGGATGAGGGTGAGGCAGGAGGG - Intronic
1184161690 22:42700918-42700940 GTGTTTAAGGTCAGGAAGCAGGG + Intronic
1184218188 22:43081268-43081290 GATGTTCAGGTCAGGCAGGATGG - Intronic
1184236355 22:43185340-43185362 CGGCCTAAGGTGAGGCAGGAGGG + Intronic
1184507721 22:44914263-44914285 GTGGAAAAGGTGTGTCAGGAGGG - Intronic
1184786272 22:46673455-46673477 GTGGCTCAGATGAGTCAGGAGGG + Intronic
950309004 3:11939618-11939640 GTGGTTGGAGTGAGGAAGGAAGG + Intergenic
951478320 3:23131884-23131906 GAGGTTATGGTGAGCCAAGATGG + Intergenic
952277794 3:31894300-31894322 GAGGACAAGGGGAGGCAGGAAGG + Intronic
952280665 3:31920143-31920165 GTGGTTTAGGGGAGGAAGGGAGG + Intronic
952398674 3:32943515-32943537 GTTGGTAGGCTGAGGCAGGAGGG - Intergenic
952804484 3:37334837-37334859 GAGTTTAAAGTGAGGCATGAAGG + Intronic
953317442 3:41942034-41942056 GTGGTTGAGGTGAAGGTGGAGGG - Intronic
953752311 3:45618162-45618184 GTGGTTGGAGGGAGGCAGGAGGG + Intronic
954347407 3:50012092-50012114 TTTGGGAAGGTGAGGCAGGAAGG - Intronic
954363498 3:50134545-50134567 GTGGGAAGGGTGAGGGAGGAGGG + Intergenic
954558987 3:51539593-51539615 GTCGTTAGGGTGAGGCCGGTGGG + Intergenic
954785484 3:53089485-53089507 TTGGGTAAAGTGAGGCAGGCTGG + Exonic
955391609 3:58526276-58526298 GTGGTGGAGGTGAGAGAGGATGG + Intronic
955695169 3:61628698-61628720 GTGGTTAAGGTGAAGCAGTTTGG + Intronic
955976465 3:64485057-64485079 GTGGTCCAGGTGAGGGATGATGG - Intergenic
957430087 3:80093036-80093058 GAGGTTACGGTGAGCCAAGATGG + Intergenic
957875922 3:86146704-86146726 GTGGTTATGGGGAGGAAAGAAGG - Intergenic
958795547 3:98703050-98703072 GTGGTTGTAGTGAGGCAAGATGG - Intergenic
959932096 3:111996280-111996302 GTGGATAGAGTGAGGCAAGAGGG - Intergenic
960600267 3:119450298-119450320 GTGTTTAAAATGAGACAGGAGGG - Intronic
961616666 3:128188142-128188164 GTGGTTAGGGTGATGAGGGAGGG + Intronic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
962894731 3:139704151-139704173 GTGGGTAAGGTGGGGGAGGAGGG + Intergenic
962895065 3:139706680-139706702 GTTGTTAAGGAAAGGCAGGAAGG + Intergenic
962963999 3:140336916-140336938 GTGGGGAAGGTGGGGCGGGATGG - Intronic
963034093 3:141010131-141010153 TTTGGGAAGGTGAGGCAGGAGGG + Intergenic
964188187 3:153972356-153972378 ATGGTTATAATGAGGCAGGAAGG + Intergenic
967739229 3:192986739-192986761 GAGGTTATGGTGAGGCGAGATGG + Intergenic
968959129 4:3734126-3734148 CTGGGGAAGGTGAGGCAGCATGG + Intergenic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969331313 4:6474727-6474749 GTGGTGGGGGTGGGGCAGGATGG - Intronic
970221744 4:13818875-13818897 GTGGTGAAGGTGGAGCAGGTGGG - Intergenic
970840277 4:20460621-20460643 GCAGTTAAGGTGAAGCAGGTTGG - Intronic
971406982 4:26330667-26330689 GTGCTTAAAGTGAGGCATGATGG + Intronic
972630983 4:40841741-40841763 GTGGTTGCGGTGAGCCAAGATGG - Intronic
972803931 4:42508195-42508217 GAGGTTATGGTGAGCCAAGATGG - Intronic
974453444 4:62095414-62095436 GTTTTCAAGGAGAGGCAGGAGGG + Intergenic
975123063 4:70750114-70750136 GGGGCTGAGGTAAGGCAGGAAGG - Intronic
975125730 4:70780358-70780380 GAGGTTAAAGTGAGCCAAGATGG - Intronic
975585393 4:75943098-75943120 GTGGCTTAGCTGAGGCAGGAAGG - Intronic
975678419 4:76850974-76850996 GGGGTAAAAGTGAGACAGGAGGG + Intergenic
978793818 4:112689458-112689480 GAGGTTACGGTGAGCCAGGATGG - Intergenic
981371684 4:143966152-143966174 GAGGTTGAGGTGAGCCAAGATGG - Intergenic
981380774 4:144069350-144069372 GAGGTTGAGGTGAGCCAAGATGG - Intergenic
982593929 4:157353285-157353307 GAGGTTATGGTGAGCCAAGATGG + Intronic
983531450 4:168813700-168813722 CTGGTGAGGCTGAGGCAGGAGGG - Intronic
987160769 5:15139955-15139977 GTGCTCTGGGTGAGGCAGGAGGG - Intergenic
987594850 5:19984376-19984398 GTGGATAATATGAGGAAGGATGG + Intronic
987769687 5:22284769-22284791 GTGGCTAAGTTGTGGCAGGGTGG - Intronic
989164011 5:38417281-38417303 GAGGTTACGGTGAGCCAGGATGG + Intronic
990119181 5:52428134-52428156 GAGGTTGAGGTGAGCCAAGATGG + Intergenic
990251781 5:53923185-53923207 TTGGTAAGGGTGAGTCAGGATGG + Intronic
991705488 5:69354063-69354085 GTGGTGAGGGGGAGGCAGGACGG - Intronic
993473101 5:88330954-88330976 GTGGTTAAGGCAAGGCATGGTGG + Intergenic
996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG + Intergenic
997294333 5:132760402-132760424 GTGGTGAAGGTGGGGCTGCACGG - Intronic
998062616 5:139131316-139131338 TTTGTTAAGGTGAAGCAGGGAGG - Intronic
998730804 5:145074657-145074679 GTGGTCAAGGTGAGAAATGATGG + Intergenic
998872037 5:146561978-146562000 GTGGTTAAGGTGAGAGATGACGG + Intergenic
999586177 5:153092162-153092184 GTGGTTAGGGTAAGACATGATGG - Intergenic
999780644 5:154847387-154847409 GGGAATAAGGTGAGGCTGGAAGG + Intronic
999831289 5:155322588-155322610 GAGGTTGAGGTGAGGGAGGGAGG + Intergenic
999948338 5:156621629-156621651 GTGATTAAGTTGAGACTGGAAGG + Intronic
1000357823 5:160417902-160417924 GTTGTAATGGTGAGGCTGGAAGG - Intronic
1000920682 5:167133183-167133205 GTGGTTAAGATAAGGAGGGAAGG + Intergenic
1001083958 5:168686965-168686987 GGGCTTCAGGTAAGGCAGGAGGG - Exonic
1001481237 5:172090497-172090519 TAGGTTAAGTTGAGGCAAGAGGG - Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003335584 6:5168899-5168921 GTGATAAAGGAGAGGGAGGAGGG + Intronic
1003751274 6:9059753-9059775 GAGGGTGAGATGAGGCAGGAGGG + Intergenic
1004020961 6:11775226-11775248 GTAGAGAAGGTGATGCAGGAGGG - Intronic
1004746604 6:18515066-18515088 GAAGTGAAAGTGAGGCAGGAGGG + Intergenic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006155360 6:32010443-32010465 GTGGTGAAGGTGATGCTGGCTGG + Intergenic
1006161666 6:32043177-32043199 GTGGTGAAGGTGATGCTGGCTGG + Exonic
1006451482 6:34108127-34108149 GTGGTGGAGGTGGGGCAGGGTGG - Intronic
1006612899 6:35305636-35305658 GCGGTTGAGGTGAGCCAGGAAGG - Intronic
1008067133 6:47061783-47061805 GGGGTGGAGCTGAGGCAGGAAGG - Intergenic
1009979132 6:70705672-70705694 GTGTTTAAGGAGTGGCAGGATGG + Intronic
1013388492 6:109657690-109657712 GGGGGTAGGGGGAGGCAGGAGGG - Intronic
1013573411 6:111453565-111453587 GTGGTAAAAGAGAGGCAGTATGG - Intronic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1014243056 6:119039610-119039632 GGGGTTGAGGAGAGGGAGGAAGG + Intronic
1014436295 6:121424507-121424529 GGGGACAGGGTGAGGCAGGAGGG + Intergenic
1014964666 6:127732529-127732551 GTGATTAGGTTGAGGCATGAAGG - Intronic
1015280028 6:131423142-131423164 GTGATGAAGGTGAAGAAGGAAGG - Intergenic
1015505784 6:133986134-133986156 GGGGGTAAAGTGAGTCAGGAAGG + Intronic
1016371735 6:143381874-143381896 GTGGTTAGGGAAAGGAAGGAAGG + Intergenic
1016618244 6:146077891-146077913 CTGCTTCAGGTGAGCCAGGAGGG + Intronic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1017673411 6:156789589-156789611 GGGGTGGAGTTGAGGCAGGAAGG + Intronic
1017986519 6:159447598-159447620 GTGGTTCAGGGGAGGGAGCAGGG - Intergenic
1018010416 6:159665042-159665064 TGAGTTAAGGGGAGGCAGGAAGG + Intergenic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019212705 6:170419377-170419399 CTGGTTAGGGTGAGGCCTGAGGG - Intergenic
1019603353 7:1896149-1896171 GAGGTCAGGGAGAGGCAGGAAGG - Intronic
1020129881 7:5553690-5553712 TTCGGGAAGGTGAGGCAGGAGGG + Intronic
1020143733 7:5627015-5627037 GAGGTTGAGGTGAGGCAGAGTGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020605101 7:10327230-10327252 GGGGTGAAGGTGGGGCAAGATGG - Intergenic
1021256035 7:18393529-18393551 ATGGATGAGGTGAGGCAGGGAGG + Intronic
1021827316 7:24568369-24568391 CTGTTTGAGGTGAGGCAGAAAGG + Intergenic
1021885444 7:25133127-25133149 GTGGTTTAGAGGAGGTAGGAGGG + Intergenic
1022194731 7:28053849-28053871 GTGGGAAAGGTGAGGATGGAAGG - Intronic
1022938259 7:35203354-35203376 GAGGTGAAAGTGAGGCAAGAGGG - Intronic
1023358567 7:39392719-39392741 GAGGCTCAGGCGAGGCAGGACGG + Intronic
1023514819 7:40991618-40991640 TTGTTTAGGGTGAGGCAGGCCGG + Intergenic
1023660786 7:42469091-42469113 GTGGCTAAGGTGTTGCAGGGAGG + Intergenic
1024133059 7:46376131-46376153 GTGGGAAAGGTGAGGTAGAATGG + Intergenic
1024154232 7:46603821-46603843 GTGGAAAGGGTGAGGGAGGATGG - Intergenic
1026206939 7:68265922-68265944 GTGGCCAAGATGAGTCAGGATGG - Intergenic
1026476867 7:70743947-70743969 GTGGTTAAAGTGTGGATGGAGGG + Intronic
1026622262 7:71960066-71960088 GTGGTTGCAGTGAGTCAGGATGG + Intronic
1031097963 7:117443546-117443568 GTGGTGAAGGTGAGGTAGAAAGG + Intergenic
1031336375 7:120538492-120538514 ATGGTCATGGTGGGGCAGGAGGG + Intronic
1031667211 7:124499329-124499351 TTTGATAAGGTGGGGCAGGAGGG - Intergenic
1032296017 7:130639024-130639046 GAGGTCAAGTTGAAGCAGGATGG - Intronic
1032381492 7:131487880-131487902 GGGGTTGAGGTCAGGCATGAAGG - Exonic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1033824640 7:145174568-145174590 GTGGTTCAGGTGAGAGATGATGG - Intergenic
1034068150 7:148156468-148156490 GTGGTCAAGCGGAGGAAGGAGGG - Intronic
1034635419 7:152563548-152563570 GTGGTTAAGGTCTGGCACCACGG - Intergenic
1034899016 7:154896063-154896085 GTGGGTTGGGTCAGGCAGGAGGG - Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035453725 7:158996191-158996213 TTGGATAAGGTGAGGCAGCCCGG + Intergenic
1036017994 8:4807491-4807513 GGGGTTTAGGTGATTCAGGATGG - Intronic
1036098365 8:5750196-5750218 GTGGGTCAGATGAGGCAGGGAGG + Intergenic
1036400155 8:8400862-8400884 GAGGTTGAGGTGAGCCATGATGG - Intergenic
1037668192 8:20990424-20990446 GAGGTTGAGGTGAGCCAAGATGG - Intergenic
1038702809 8:29865038-29865060 TTCCTTTAGGTGAGGCAGGAAGG - Intergenic
1040562966 8:48540890-48540912 GTGGTCAAGGTGAGTGAGGCGGG + Intergenic
1041311425 8:56520942-56520964 GTAGGTAAGGTGATTCAGGAAGG + Intergenic
1041386835 8:57313153-57313175 GGGGTCAAGAGGAGGCAGGAAGG - Intergenic
1041714410 8:60921290-60921312 GCTGTTAAGGGGAGGCAGGCTGG - Intergenic
1042037616 8:64553305-64553327 CTGGTTAGGCTGAGGCAGAATGG - Intergenic
1042564786 8:70100776-70100798 CTAGTGAAGGTGGGGCAGGAGGG - Intergenic
1046927660 8:119809548-119809570 ATGGTTAAGCTTAGGGAGGAAGG - Intronic
1047896425 8:129371460-129371482 GTGGTTAATGTGAAGCAACAAGG - Intergenic
1051785685 9:20740684-20740706 GGGATTTAGGTTAGGCAGGATGG + Intronic
1053575094 9:39351539-39351561 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053839600 9:42179474-42179496 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054096659 9:60910222-60910244 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054118062 9:61185848-61185870 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054589693 9:66996716-66996738 ATGATTAAGGTGAGTGAGGAAGG - Intergenic
1054986239 9:71264778-71264800 ATGCTTAAGGTGAGGGAGGGTGG - Intronic
1056099540 9:83287578-83287600 ATGGTGAAGGTGAGGTAGAAAGG - Intronic
1057216315 9:93230735-93230757 GTAGTGAAGGTGAGACGGGAGGG - Intronic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1058582074 9:106469209-106469231 GGGGGAAAGGTGAGACAGGATGG - Intergenic
1058642017 9:107096830-107096852 GGGGTTGAGGTGTGACAGGAAGG + Intergenic
1060194181 9:121612578-121612600 GGGGTAAAGGTGGGGCAGGGCGG + Intronic
1060601486 9:124881290-124881312 TTGGTGAAGGTGAGGCGGGGTGG + Intronic
1060631488 9:125163012-125163034 GAGGTTACAGTGAGCCAGGATGG + Intronic
1062117286 9:134816336-134816358 TCGGTCAAGGTAAGGCAGGAAGG - Intronic
1185600439 X:1335480-1335502 GAGGTTACAGTGAGCCAGGATGG - Intergenic
1185600495 X:1335791-1335813 GAGGTTACAGTGAGCCAGGATGG - Intergenic
1186452102 X:9682647-9682669 TTGGATAAGGCGAGGCAGAAGGG + Intronic
1187260515 X:17681467-17681489 GTAGTTAAGCTATGGCAGGATGG - Intronic
1187512579 X:19935117-19935139 GAGGTTACAGTGAGCCAGGATGG + Intronic
1187556236 X:20354805-20354827 GTGGGTGAAGTGAGGAAGGAGGG + Intergenic
1188601832 X:31976124-31976146 GTAGTTAAAGTGAGGAAAGATGG + Intronic
1188644864 X:32553398-32553420 GTGGTCTATGTGAGGCTGGAGGG + Intronic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1189757078 X:44282881-44282903 GTGGTAAAGGAGGGGCTGGATGG + Intronic
1190185323 X:48228626-48228648 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190190722 X:48274694-48274716 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190328613 X:49222136-49222158 GGGGTTAAGGTCAGCAAGGAAGG - Intronic
1190484313 X:50909811-50909833 ATGGTTAATGTGAAGCAGCAGGG - Intergenic
1190664860 X:52687299-52687321 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190674562 X:52771120-52771142 ATGGTGATGGTGAGGCTGGAAGG - Intronic
1192250190 X:69406564-69406586 GTGTTTAAGGTAAAGCAAGAAGG + Intergenic
1193241570 X:79176155-79176177 GTGGTGGAGGTAAGGGAGGAGGG + Intergenic
1195466647 X:105186490-105186512 TTGGATAAGGTGAGACAGGGAGG + Intronic
1195994764 X:110720736-110720758 GTGTTTAAACTGAAGCAGGAAGG - Intronic
1197423022 X:126261947-126261969 GTGGTTACAGTGAGCCAAGATGG - Intergenic
1198728378 X:139700995-139701017 GTGGATCTGGGGAGGCAGGAGGG - Intronic
1199514984 X:148665965-148665987 GTGGGGAGGGTGAAGCAGGATGG + Intronic
1199597020 X:149514125-149514147 GTGGTTAATTTTTGGCAGGATGG - Intronic
1200232556 X:154451277-154451299 TTGGCTAAGCTGAGGCAGGCAGG + Intergenic
1200367402 X:155681513-155681535 GTGATTAAGCTTAGGGAGGAAGG + Intergenic