ID: 1189702904

View in Genome Browser
Species Human (GRCh38)
Location X:43730361-43730383
Sequence TGTTAAATAGTTCTCTTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189702904 Original CRISPR TGTTAAATAGTTCTCTTGAG CGG (reversed) Intronic
900845340 1:5095462-5095484 TGTTAAACAGTTTTCTAAAGTGG - Intergenic
908071345 1:60463762-60463784 TCTTAAAGAGTTCTCTTAAGTGG + Intergenic
908598001 1:65708963-65708985 CGTCAAATACTTCTCTTGATCGG + Intergenic
909338669 1:74506941-74506963 TGTTGAATAAGTTTCTTGAGGGG + Intronic
909441969 1:75706862-75706884 TGTGAAATATTTCTCATGATTGG + Intergenic
910315278 1:85875329-85875351 TGTTAAATTATTCTCTTGTAGGG - Exonic
910409678 1:86927109-86927131 GGATAAATAGTTCTGTTCAGAGG + Intronic
910494466 1:87811131-87811153 TCTTAATTACTTCTCCTGAGGGG + Intergenic
911305855 1:96231372-96231394 TGTTAATTAGTACTATTAAGAGG + Intergenic
916830280 1:168483983-168484005 TGTGTAATAGTTGTCATGAGAGG + Intergenic
918493785 1:185111353-185111375 TGTTAAATGTGACTCTTGAGAGG - Intergenic
920741361 1:208584197-208584219 TGTGAAACTGTTCTCTTCAGGGG - Intergenic
921498050 1:215865086-215865108 TTTTAAATTGTTGTCTTGATTGG - Intronic
922317308 1:224453892-224453914 GTTTTAATAGTTCTGTTGAGGGG - Intronic
1063280546 10:4625006-4625028 TGATAAATAGTTTTCTTAGGGGG - Intergenic
1063377925 10:5565226-5565248 AGTTACATGGTTCTCTTGGGTGG + Intergenic
1064719069 10:18209793-18209815 TGTTGAATATTTCTCTGGACAGG + Intronic
1064805878 10:19131738-19131760 TGTTAAATATTTTTCTTGAAAGG + Intronic
1065656365 10:27955667-27955689 GGTTAAAGAGTTCTTTCGAGTGG - Intronic
1068144762 10:53053946-53053968 TATTAAATAATTCTTCTGAGAGG + Intergenic
1068338898 10:55675362-55675384 TGTTAATTATTTCTTTTGATGGG + Intergenic
1071917100 10:90305664-90305686 TGTTAAATGTCTTTCTTGAGTGG - Intergenic
1072512818 10:96145587-96145609 TGTTAAAGTGTTCTCTGCAGTGG + Intronic
1073055447 10:100697755-100697777 AGTTAACTAGGTCTCTCGAGGGG + Intergenic
1075139298 10:119817327-119817349 TATTAAATAGTTCTTTTGGGTGG + Intronic
1075323136 10:121508414-121508436 TGTTAAATTTTTCTCTTCTGAGG - Intronic
1078224897 11:9383078-9383100 TGTTCAACATTTCTCTTCAGAGG + Intergenic
1078959143 11:16243143-16243165 TGTTAATTATTTTCCTTGAGGGG - Intronic
1080618331 11:33965275-33965297 TGTCAAATTGTTCTCTAAAGTGG - Intergenic
1080840830 11:35982066-35982088 TATTAAATAGTTTTCTGGAGTGG + Intronic
1081909838 11:46693900-46693922 TGGTAAATGGCTCTCTGGAGAGG - Intronic
1082152138 11:48753040-48753062 TGTTAAATATTTCTTTTGATTGG - Intergenic
1083977882 11:66138644-66138666 TACTAAATAGGACTCTTGAGAGG + Intronic
1087910611 11:103749484-103749506 TGCTAAAAAGTGATCTTGAGTGG + Intergenic
1088297925 11:108321206-108321228 TGTTAAAGAGTTCTCATCATAGG - Intronic
1089707333 11:120288911-120288933 TGTGAAAAAGGTGTCTTGAGAGG - Intronic
1093303132 12:17478546-17478568 TGTACAATATATCTCTTGAGGGG + Intergenic
1093877699 12:24369886-24369908 TGTTAGTAAGTTCACTTGAGTGG - Intergenic
1095075362 12:37914904-37914926 AGTTAAATCCTTCTCTTGATGGG - Intergenic
1096418651 12:51436552-51436574 TTTTAAATAGTTACCTAGAGAGG - Intronic
1096965292 12:55621885-55621907 TGTTGAAAAGTTCTTTTGGGGGG - Intergenic
1097388273 12:58977633-58977655 TTTTAAAATGTTCTCTCGAGCGG + Intergenic
1098904017 12:76143159-76143181 TGTTTTAAAGCTCTCTTGAGAGG + Intergenic
1101862163 12:108491522-108491544 TATTTAAGATTTCTCTTGAGTGG - Intergenic
1107030530 13:35848180-35848202 TTTTAAATTGTTCTACTGAGCGG - Intronic
1107264584 13:38537966-38537988 TTTAAAATATTTATCTTGAGGGG - Intergenic
1107309722 13:39063253-39063275 TTTCAAACAGATCTCTTGAGTGG - Intergenic
1108222690 13:48253010-48253032 TGCTAAATTGTTTTCTTAAGTGG + Intronic
1109222165 13:59651309-59651331 TGATAAAATGATCTCTTGAGGGG - Intergenic
1111550804 13:89809755-89809777 TGTTAAATATTCATCTTGGGTGG + Intergenic
1114375099 14:22137135-22137157 TGTTACATTGTTATATTGAGAGG - Intergenic
1114397143 14:22374675-22374697 TGTTAATTAATTCACTTGATGGG + Intergenic
1115106503 14:29768296-29768318 TGTTAAATAGTTAACTTGACTGG - Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1117807820 14:59513161-59513183 TATAAAAAAGTTCACTTGAGGGG + Intronic
1119535081 14:75396313-75396335 TGTAAAATAGAGCTGTTGAGAGG + Intergenic
1120584651 14:86297029-86297051 TGTTAAATCGTCCTCTCAAGAGG + Intergenic
1126899608 15:53300825-53300847 TTTTAAATAGTTTTGCTGAGTGG + Intergenic
1127051669 15:55090146-55090168 TTTGAAATAGTCCTCTTGGGAGG - Intergenic
1129370668 15:75092104-75092126 TGCTAAACAGGTCTCCTGAGTGG - Intronic
1129998706 15:80028594-80028616 TATTAAATAGTTCTCCTAACTGG + Intergenic
1131915085 15:97256358-97256380 TGTTAAATAATTCCCTTTAACGG - Intergenic
1135665488 16:24332143-24332165 TGTTCAATAGATATCTGGAGAGG - Intronic
1136925134 16:34364809-34364831 TCTTAAAAAGTTTCCTTGAGTGG - Intergenic
1136979439 16:35046997-35047019 TCTTAAAAAGTTTCCTTGAGTGG + Intergenic
1138112412 16:54335205-54335227 TGTCAAATTGTTCTCTAAAGTGG + Intergenic
1140146189 16:72311840-72311862 TATTAAATAGTTGACATGAGGGG - Intergenic
1140271584 16:73471050-73471072 CTTTAAATATTTCTCTTTAGAGG + Intergenic
1143243843 17:5466993-5467015 GGTTAAATAATTGTTTTGAGGGG + Intronic
1143880458 17:10025966-10025988 TGTTAAATAGTTTATTTGAAGGG - Intronic
1144162493 17:12574287-12574309 TGTGAAACAGTTCTCTTCACTGG + Intergenic
1144672236 17:17139371-17139393 TGTGAAATTGTTTTATTGAGGGG - Intronic
1145119469 17:20244391-20244413 TTTTAAATAATTTTATTGAGAGG - Intronic
1146994552 17:37307295-37307317 TGCTAAATAGTTTTCTAAAGTGG + Intronic
1149898144 17:60447243-60447265 TCTTAAATAGTTTTATTTAGGGG + Exonic
1150855691 17:68750429-68750451 TCTTAAAGAGTTTTTTTGAGAGG + Intergenic
1151152066 17:72096838-72096860 TTTTAAATAGGTCTCTGGAATGG - Intergenic
1154052407 18:10973610-10973632 TTTTAAATTGTTGTATTGAGCGG + Intronic
1156416933 18:36905056-36905078 TGTTAAATAATTATCTTGTAAGG + Intronic
1156693635 18:39739424-39739446 TTTTAAATAGTTCCCGTAAGTGG - Intergenic
1157851191 18:51052540-51052562 TGTTAAATATTTCTCTTTATGGG - Intronic
1167976366 19:53229937-53229959 TCTTAAATAGGTTTCTTGATAGG + Intergenic
1168341445 19:55625426-55625448 CTTTAAATAGTTTTCTTGAAAGG + Intergenic
929662564 2:43803089-43803111 TGTTAAACTGTTTTCTAGAGTGG - Intronic
930178321 2:48323415-48323437 TGTTAAATAGCTCTTCTGACTGG + Intronic
930565702 2:53017539-53017561 TGCCAAATAGTTTTCCTGAGTGG - Intergenic
930653694 2:53987557-53987579 TGTCAAACAGTTTTCTAGAGTGG + Intronic
931365946 2:61619150-61619172 TTTTAAATAGTTCTATGGGGTGG + Intergenic
933945476 2:87282790-87282812 TTGAAAATAGTTCTCTTAAGCGG + Intergenic
935254969 2:101301831-101301853 CTTTAAATAGTTGTCTTGAGAGG - Intronic
935501818 2:103850351-103850373 TGTTATATATTTGTTTTGAGAGG + Intergenic
935849371 2:107201638-107201660 TGCAAAATAGTTGTCTAGAGAGG + Intergenic
936334733 2:111578798-111578820 TTGAAAATAGTTCTCTTAAGCGG - Intergenic
938029831 2:127982567-127982589 CGTAAAATAGTTATCTGGAGTGG + Intronic
939639600 2:144623444-144623466 TTTTAAACAGTGCTCTAGAGTGG + Intergenic
940372216 2:152916270-152916292 GGTTAAAAATTTCTCCTGAGGGG + Intergenic
941324771 2:164100195-164100217 TGTTAAAGAGTTCTGGTGTGTGG - Intergenic
942321800 2:174742370-174742392 CCTTAAATAGTTCTCTTGCTGGG - Intergenic
942466481 2:176212724-176212746 TGTTAAATAATTCAGTTGTGAGG + Intergenic
943825579 2:192386968-192386990 TGTTAATTTCTTCACTTGAGTGG - Intergenic
947620290 2:231585817-231585839 TATTAAGTAGTTCTCATAAGAGG - Intergenic
947972353 2:234334677-234334699 TGTGCCATAGTTTTCTTGAGAGG - Intergenic
948622801 2:239247047-239247069 TGTAAAATAGTTTTCTGGATAGG + Intronic
1170837762 20:19899677-19899699 TGTCAAATGGTTCTCTTCACAGG + Intronic
1172210398 20:33193963-33193985 TCTTAAAAACTTCTCTAGAGTGG - Intergenic
1173833655 20:46110698-46110720 TGTTTCATATTTATCTTGAGTGG + Intergenic
1173881354 20:46414879-46414901 TGTTAAGTAGGTCTCTGGAAAGG + Intronic
1174911191 20:54609223-54609245 TGTTAAACAGTTCTTTAGATGGG + Intronic
1174981533 20:55400824-55400846 TCTTAAATAATTTTCTTGAATGG + Intergenic
1177948506 21:27503562-27503584 TGTTAAATATTTGTCTTGCTTGG - Intergenic
1178252942 21:31021775-31021797 TGCAAAATAGTGCTCTTCAGTGG - Intergenic
950877698 3:16291807-16291829 TATTAAATTGTTTTCTAGAGTGG + Intronic
951048488 3:18067704-18067726 TGTTACTTGTTTCTCTTGAGGGG + Intronic
951355409 3:21661013-21661035 TGTGAAATATTTCTTTTCAGTGG - Intronic
951417634 3:22444602-22444624 TGTTTAATGGTTCTCTTGGTAGG - Intergenic
956263374 3:67370202-67370224 TGTTTAAAAGTTCTCTTGAAAGG + Intronic
956710452 3:72034657-72034679 TGCTAAATAGTTCTCTAAAGTGG + Intergenic
957340305 3:78887293-78887315 TGTTAAAAAGGGCTGTTGAGAGG + Intronic
957617417 3:82548442-82548464 TGGTCAAAATTTCTCTTGAGTGG - Intergenic
960221694 3:115119140-115119162 TTTTAAATTGTGGTCTTGAGAGG - Intronic
962434671 3:135355400-135355422 TGTTAAACAGAGATCTTGAGTGG + Intergenic
963279162 3:143364948-143364970 TGTTAAATAGGTTTCTTAAATGG + Intronic
964217380 3:154301623-154301645 AATTAAATAGTTCTCTAGCGTGG - Intronic
964478853 3:157122164-157122186 TGTTTGAGAGTACTCTTGAGAGG - Intergenic
969886648 4:10221056-10221078 AGTTAAACAGTTGTCTTGGGGGG + Intergenic
970084699 4:12333807-12333829 TCTTAAATTTTTCTCTGGAGAGG - Intergenic
971588560 4:28436781-28436803 TGAAAAATTGTTCTCTTGTGGGG + Intergenic
972650488 4:41013164-41013186 TTTAAAATAGTTCTCTTAATTGG + Intronic
973134687 4:46692100-46692122 TGTCAAATTGTTCTCTAAAGAGG - Intergenic
973222796 4:47748050-47748072 TTCCAAATAGTTCTCTTAAGAGG + Intronic
975988026 4:80223104-80223126 TGTCAAATAGCTCTCTCAAGTGG + Intergenic
976444978 4:85119287-85119309 TGTGAAATAGTCATCTAGAGAGG - Intergenic
978392084 4:108237740-108237762 TGTTTTATAGTTCACTTGTGAGG - Intergenic
980146516 4:128992113-128992135 TGTTAATTATTTTTCTTCAGGGG - Intronic
980156331 4:129111616-129111638 TGTGAAATAGTTGTCCTGAAGGG - Intronic
982619722 4:157689118-157689140 TGTTAAATTTTTGACTTGAGTGG - Intergenic
982749122 4:159137947-159137969 TTTTAAATTCTTTTCTTGAGTGG + Intronic
984589613 4:181602598-181602620 AGTGAAATAGTTCTCAAGAGTGG - Intergenic
986586480 5:9323503-9323525 TGATAAATAGTTCTGATAAGTGG - Intronic
986814319 5:11391688-11391710 TGTTTGATGATTCTCTTGAGGGG + Intronic
989855497 5:46283076-46283098 AGTTAAATACTTCTTTTGATGGG - Intergenic
994616320 5:102108305-102108327 TGTTAAATTGTGTCCTTGAGGGG + Intergenic
994793299 5:104259878-104259900 AGTAAAAGAGTTCTCTAGAGAGG + Intergenic
996467133 5:123816096-123816118 TGTTAAATAATTCACTGCAGTGG + Intergenic
997419996 5:133758939-133758961 TCTGAAATAGTTTGCTTGAGGGG - Intergenic
1000594188 5:163194953-163194975 TGGGAAATAGTTTTCTTAAGAGG - Intergenic
1003020199 6:2502901-2502923 TGTGAAATAGCCCTCCTGAGGGG + Intergenic
1004762447 6:18683156-18683178 ACTTAAATAGTTCTTTTGGGTGG + Intergenic
1004858194 6:19772937-19772959 TGTTACATAGTTCTCTGCTGGGG + Intergenic
1005348846 6:24914651-24914673 GCTTAAAAAGTTCTCATGAGAGG - Intronic
1006056389 6:31387887-31387909 TGTCAAATTGTTCTCTGAAGAGG + Intergenic
1006069111 6:31484839-31484861 TGTCAAATTGTTCTCTGAAGAGG + Intergenic
1008575586 6:52857083-52857105 TGTTAAATTATACTATTGAGTGG + Intronic
1009558502 6:65206980-65207002 TGTTGAATAGTATTTTTGAGAGG - Intronic
1010029851 6:71262328-71262350 TATTAAATATTACTCTTGGGAGG - Intergenic
1014366146 6:120544620-120544642 TATTAAATAGTTCCCTGGGGAGG + Intergenic
1015568706 6:134600208-134600230 TGTAGAATAGTTCTCTTCATGGG - Intergenic
1019283556 7:212160-212182 TGATTAATAGTTCTCTTTAAAGG + Intronic
1020584327 7:10047140-10047162 TGGAAAATAGTTATCTTCAGAGG - Intergenic
1022688374 7:32618700-32618722 AGTGAAATAGTTCTTTTGAAGGG + Intergenic
1023781375 7:43659041-43659063 TGTTAAAGATTTCTCTAGAAAGG + Intronic
1025074952 7:55934814-55934836 TGTCAAATTGTTCTCTTAAAAGG - Intronic
1025747233 7:64253933-64253955 TGCTAAATACTTTTCTTCAGTGG - Intronic
1026103926 7:67406088-67406110 AGTTAAAAACTTCTCTGGAGTGG + Intergenic
1027697174 7:81426211-81426233 TATAAAATGTTTCTCTTGAGGGG + Intergenic
1028330271 7:89581793-89581815 TTTTAAATATTTCTCTTCATAGG - Intergenic
1029603073 7:101581308-101581330 TGTAAAATTGATCTCTTGGGCGG - Intergenic
1029922812 7:104283696-104283718 CTTTAAATAGTTGTCTTAAGGGG - Intergenic
1030784032 7:113638055-113638077 TGTTCAATAGGTTTCTTTAGTGG + Intergenic
1031137957 7:117906397-117906419 TGTTAAATAATTATATAGAGTGG - Intergenic
1031487487 7:122345932-122345954 TGTTAAATGGCTATCTTGAAAGG + Intronic
1031879801 7:127184592-127184614 TGTTAACTAGGACTGTTGAGAGG - Intronic
1031929089 7:127666089-127666111 TGTTAAGCTGTTCTCTTGTGAGG + Intronic
1037463731 8:19138870-19138892 TGTTAAAGATTTGGCTTGAGAGG + Intergenic
1038296463 8:26295610-26295632 GGTTAAATAATTTTCTTTAGAGG + Intronic
1044859878 8:96512503-96512525 TATTAAACAGTTCTCTTTGGGGG - Intronic
1050122123 9:2318159-2318181 TGTTAAATTGTTGTCCTCAGAGG + Intergenic
1050379209 9:5008736-5008758 TGTTAAAAAGATCTGCTGAGAGG - Intronic
1051061838 9:13053931-13053953 TGCTAAAGAGCTCTCTTGAAAGG - Intergenic
1051297102 9:15608398-15608420 TGCCAAATTGTTCTCTTAAGTGG + Intronic
1051454047 9:17232427-17232449 TATTAAATAATTCTCATGAAAGG + Intronic
1053700813 9:40688296-40688318 TGTTAATTAGTTATATTGAAAGG - Intergenic
1054312106 9:63487694-63487716 TGTTAATTAGTTATATTGAAAGG - Intergenic
1054410880 9:64811751-64811773 TGTTAATTAGTTATATTGAAAGG - Intergenic
1055632863 9:78241175-78241197 TGTGAAATAGTGGTCTGGAGGGG + Intronic
1056031481 9:82558219-82558241 TGATAAATAGTTATCTCTAGTGG + Intergenic
1056967265 9:91175632-91175654 TGTAAAAAAGTTCTTTTTAGTGG - Intergenic
1056974726 9:91241750-91241772 TGTTAAATACAACTCTTAAGGGG - Intronic
1057096859 9:92318584-92318606 TGGTAAATAATTATGTTGAGAGG + Intronic
1058610097 9:106766563-106766585 TGTTATATAATTGTATTGAGAGG + Intergenic
1060122340 9:121005180-121005202 TATTATATAATTCTCTTTAGGGG + Intronic
1061107399 9:128542189-128542211 TGTTCACTGGTACTCTTGAGTGG + Exonic
1186293105 X:8121400-8121422 TGTTAATAGGTTCCCTTGAGAGG + Intergenic
1186635425 X:11399146-11399168 TATTAAATAGTAGACTTGAGTGG + Intronic
1187068486 X:15864556-15864578 TGTTGAATAATTCACATGAGAGG + Intergenic
1189702904 X:43730361-43730383 TGTTAAATAGTTCTCTTGAGCGG - Intronic
1190889130 X:54553855-54553877 TGTTAAATAGGGCAGTTGAGAGG + Intronic
1193342497 X:80366152-80366174 TATTAAATAGATCTCTCTAGTGG + Intronic
1195980650 X:110574506-110574528 TGTACAATGGCTCTCTTGAGAGG + Intergenic
1200915342 Y:8566528-8566550 TGTTCAGTAGTGCTTTTGAGGGG - Intergenic
1200931882 Y:8704210-8704232 TGTCCATTAGTTCTGTTGAGGGG + Intergenic
1200932431 Y:8709171-8709193 TGTCCATTAGTTCTGTTGAGGGG + Intergenic
1200984424 Y:9290695-9290717 TGTCCAGTAGTTCTGTTGAGAGG + Intergenic
1202126018 Y:21569549-21569571 TGTCCAGTAGTTCTGTTGAGAGG - Intergenic