ID: 1189703635

View in Genome Browser
Species Human (GRCh38)
Location X:43737533-43737555
Sequence CAGAAAAGGCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1559
Summary {0: 1, 1: 0, 2: 11, 3: 152, 4: 1395}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189703626_1189703635 19 Left 1189703626 X:43737491-43737513 CCTGTTCCGTAGGTAGCACTTTC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG 0: 1
1: 0
2: 11
3: 152
4: 1395
1189703627_1189703635 13 Left 1189703627 X:43737497-43737519 CCGTAGGTAGCACTTTCTCATGG 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG 0: 1
1: 0
2: 11
3: 152
4: 1395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189703635 Original CRISPR CAGAAAAGGCAGAAGGAGGA AGG Intronic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900788615 1:4665450-4665472 CAAAAAATGCTGAAGGAAGAAGG - Intronic
900977146 1:6025059-6025081 GGGAGAAGGGAGAAGGAGGAAGG - Intronic
901235944 1:7667665-7667687 CAGAAAGGACAGAAGGAGTCAGG - Intronic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902618971 1:17639547-17639569 GAGAGAAGGGAGATGGAGGAAGG - Intronic
902778921 1:18692199-18692221 AAGAAAAGGAAGAAGGTGGAAGG + Intronic
903269564 1:22178795-22178817 CAGAGAAGGAAGGAGAAGGAAGG - Intergenic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
903857819 1:26346985-26347007 GAGAAAAGGAAGAAGGCAGAAGG + Intronic
903929734 1:26855292-26855314 GAGAAAAGGAAGAAGGTGCAGGG + Exonic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
903977081 1:27157441-27157463 GAGATAAGCCAGAGGGAGGAAGG + Intronic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
904962764 1:34347768-34347790 GAGACAAGGCAGAGGCAGGATGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905110793 1:35593009-35593031 AAGAAAAGACAGAGAGAGGAGGG + Intronic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905282734 1:36859526-36859548 CCGAGAAGGCAGAAAGAAGAAGG - Intronic
905388987 1:37624294-37624316 CATAACAGGCAGCAGCAGGAGGG - Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905715738 1:40148171-40148193 CAAAACAGAAAGAAGGAGGAGGG - Intergenic
906227106 1:44131089-44131111 TAGAAAAGCCAGAATGAGGCCGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906510071 1:46405742-46405764 CAGATGCCGCAGAAGGAGGAGGG - Exonic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907088918 1:51706474-51706496 CAAAAATGACAGGAGGAGGAAGG - Intronic
907313603 1:53553851-53553873 CAGAACGGGCAGGTGGAGGATGG + Intronic
907337025 1:53706515-53706537 CAGAAAATGCTGAAGGCGGCAGG - Intronic
907528614 1:55070360-55070382 CAGAAGAGGCAGTACTAGGAAGG + Intronic
907749382 1:57247386-57247408 CAGTCATGGCAGAAGGAGAAGGG - Intronic
908469508 1:64429940-64429962 CAGAAAAGCAAGGAAGAGGAAGG - Intergenic
908499961 1:64733333-64733355 CAGAGAAGGCAGCAGGACAAAGG - Intergenic
908607720 1:65818399-65818421 GACAATAGGAAGAAGGAGGATGG - Intronic
908736367 1:67281135-67281157 CAGAAAGGGAGGAAGAAGGAAGG + Intergenic
908860830 1:68486345-68486367 CAGTCATGGCAGAAGGTGGAGGG - Intronic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
909300856 1:74011387-74011409 CAGAAAAGCTGGAAGGAGAAGGG + Intergenic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
909929196 1:81475747-81475769 CAGAAAAGACACAAAGAGTAGGG + Intronic
910008264 1:82427296-82427318 CATAAATGGAGGAAGGAGGAAGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910734732 1:90441009-90441031 AAGAAAAGGGAGAAGAGGGAAGG - Intergenic
911008753 1:93255777-93255799 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
911167919 1:94741547-94741569 CAGGAAAGGCAGAAGTTAGAAGG + Intergenic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911260588 1:95680645-95680667 CCGAAAGGGGAGAGGGAGGAAGG - Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
911604520 1:99888037-99888059 AAGAAAAGGAAGATGGTGGAGGG + Exonic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
912207547 1:107525016-107525038 GAGAAAAGGAAAAAAGAGGAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912538414 1:110394055-110394077 CAACAAAGGCAAAAGGAGGATGG - Intergenic
912928358 1:113932924-113932946 CAGCAAAGGCTGAAGGAAAACGG - Intronic
913008868 1:114662964-114662986 AGGAAAAGGAAGAAGGAAGAGGG + Intronic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913275991 1:117138185-117138207 TAGAGATGGCGGAAGGAGGATGG - Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
913703045 1:121392294-121392316 AAGAAAAGTAAAAAGGAGGAGGG - Exonic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
915218008 1:154352720-154352742 CAGAAAAGGCACTAGGACGATGG - Intergenic
915294200 1:154908696-154908718 TAGAAAAGGCAGGAGCAGAAAGG + Intergenic
915342516 1:155184306-155184328 CAGACACGGGAGAAGGAGCAGGG - Exonic
915427318 1:155837441-155837463 CTGAAAAGGCAGAAAGGGAAAGG - Intronic
915495635 1:156280943-156280965 AAGAAAGGGCAGCAGGAGAAAGG - Intronic
916069442 1:161161292-161161314 CAGAAAAGGCAGAGGATGGCAGG - Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916538208 1:165724881-165724903 CAGAAAGGGCAGAAGCAGGTGGG + Exonic
916562129 1:165942054-165942076 AGGAAAATGCAGACGGAGGAAGG - Intergenic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
916875460 1:168963981-168964003 AGGAAAAGGAAGGAGGAGGAAGG - Intergenic
916893458 1:169136622-169136644 CATGAATGGCAGAAGAAGGAGGG - Intronic
917334405 1:173913351-173913373 CACAAAAGGCAGTGGGGGGAAGG + Intronic
917512545 1:175680292-175680314 CAGAAAAGGGAGAGGGGGCAGGG + Intronic
918316852 1:183329690-183329712 AAGAAAAGGTAGGAGCAGGAAGG - Intronic
918531856 1:185531673-185531695 CAGAAAGGGCAGAAGGGGATAGG - Intergenic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
919851925 1:201678838-201678860 GAGAAAAAGTCGAAGGAGGAAGG + Intronic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920127113 1:203702144-203702166 AGGAAAAGGGAGAAGGAAGATGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920341552 1:205278273-205278295 GAGAAAATGAAGAAGAAGGAAGG - Intergenic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920619387 1:207529179-207529201 TGGAAAAGAAAGAAGGAGGAAGG - Intronic
920621169 1:207547734-207547756 TGGAAAAGAAAGAAGGAGGAAGG - Intronic
920693176 1:208162208-208162230 CAGGAAGGGCAGAAGGCTGAGGG + Intronic
920737942 1:208552241-208552263 GAGAAAAGGAAGCAGAAGGAAGG - Intergenic
921003876 1:211072786-211072808 CAAAAAAGGCAGAAAAAGAATGG + Intronic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921055310 1:211538513-211538535 CAGAAGGGGCAGATGGGGGAGGG + Intergenic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
921382539 1:214539655-214539677 AAGGAAGGGAAGAAGGAGGAGGG + Intronic
921591325 1:217007714-217007736 AAGAAAAGATGGAAGGAGGAAGG - Intronic
922089522 1:222382396-222382418 CAGAAAGGGCAGAAAGGGCAAGG + Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
922323291 1:224506395-224506417 AAGCCAAGGCTGAAGGAGGAAGG - Intronic
922628408 1:227077542-227077564 GAGACAAGAAAGAAGGAGGATGG - Intronic
922643485 1:227260765-227260787 CAGATAAGGGAGAAGAAGAATGG - Intronic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923414276 1:233739610-233739632 AGGAAAAGGCTGAAGGAAGATGG + Intergenic
923549734 1:234954036-234954058 CAGAAAGGAGGGAAGGAGGACGG + Intergenic
923800663 1:237205561-237205583 CAGAAAGGTCAGAGGCAGGATGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
924131859 1:240917673-240917695 CAGAGAAGGCAGAAAGAGACAGG + Intronic
924611979 1:245580856-245580878 CAGCATGGGCAGAACGAGGAAGG - Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1063179315 10:3583650-3583672 GACAAAAGGCAGAATGAGCAGGG + Intergenic
1063186917 10:3660099-3660121 AAGATAAGGCAGAAGCAGCAAGG + Intergenic
1063197835 10:3759675-3759697 CAGGAAAGGAAGAAAAAGGAAGG + Intergenic
1063268408 10:4479493-4479515 CTGAAAAGGGAGATGGATGAGGG + Intergenic
1063911648 10:10836212-10836234 AAGAAAAGGAGAAAGGAGGAGGG + Intergenic
1064317266 10:14269965-14269987 ACGAAAAGGCTGAAGAAGGATGG + Intronic
1064409959 10:15096763-15096785 GATAAAAGGGAGAAGGAGTATGG - Exonic
1064890116 10:20161733-20161755 CAGAAAAGGTAGAATGCGGCTGG + Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065750439 10:28881273-28881295 GAAAGAAGGCAGAAGAAGGAAGG + Exonic
1065791187 10:29262424-29262446 GTGAAAAGGCAGATGGAGAAAGG - Intergenic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066264525 10:33763042-33763064 CAGAGAAGGCATAAGGAACATGG - Intergenic
1066292231 10:34025077-34025099 AAGAAAAGGTGGATGGAGGAAGG + Intergenic
1066625680 10:37403001-37403023 CAGAAAAGGCTGGAAGAGAAAGG + Intergenic
1066680872 10:37936241-37936263 CAGAAAAGGCAGGACTGGGATGG - Intergenic
1067279874 10:44863079-44863101 GAGAAAAGGCAGTGGCAGGAAGG + Intergenic
1067349378 10:45462240-45462262 GAGAAAGGTCAGAATGAGGAGGG + Intronic
1067728727 10:48793535-48793557 TAGAAAAGGATGAGGGAGGATGG - Intronic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068083524 10:52347445-52347467 CAGACCAGGCACAAGGAGCAGGG - Intergenic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1068451214 10:57191643-57191665 CAGCAAAAGCCGTAGGAGGAGGG - Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069281689 10:66662583-66662605 CAGAAAGGACAGAGGAAGGAAGG - Intronic
1069432285 10:68348529-68348551 AAAAAAAGGCAGCAGCAGGAAGG + Intronic
1069742250 10:70692254-70692276 CAGAAGAGCCAGGCGGAGGAGGG + Intronic
1069797311 10:71061693-71061715 CAGCAAAGGCTGAGAGAGGAGGG - Intergenic
1070269105 10:74934668-74934690 GAGAAAAGGCTCAAGGAAGAAGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070837002 10:79454364-79454386 CAGGAAAGCCAGTAGCAGGAAGG - Intergenic
1071102295 10:82053294-82053316 TATTAAAGGCAGAAGGATGAGGG + Intronic
1071379767 10:85046654-85046676 CAGATATGGGAGAAGGAGAAAGG + Intergenic
1071394570 10:85208912-85208934 CAATCATGGCAGAAGGAGGAAGG + Intergenic
1071405925 10:85332414-85332436 CAGAAAAGGAAGAAGGCAGAGGG - Intergenic
1071409256 10:85372447-85372469 CAAAAAAGGCAAAAGCAGAAAGG - Intergenic
1071444897 10:85736304-85736326 GAGAGAAGGAAGAAAGAGGAAGG + Intronic
1071468456 10:85961733-85961755 AAGGAAAGATAGAAGGAGGATGG - Intronic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1071920739 10:90347194-90347216 CAGACAAGGAAGAAGGAACAAGG + Intergenic
1072519525 10:96218784-96218806 TAGATAAGACAGAAAGAGGAGGG - Intronic
1072847852 10:98852288-98852310 CAGAAAAGGTAGCAGGTGAAAGG - Intronic
1073136684 10:101224342-101224364 AATAAAAGGCAGAAGGGGAAGGG + Intergenic
1073184412 10:101607146-101607168 CACAAAAAGCAGAACCAGGAGGG - Intronic
1073478861 10:103772834-103772856 TAGAAAGGGCACAAGGATGAAGG - Intronic
1073908091 10:108307865-108307887 CAGAAAAGAAAAAAGGAAGATGG + Intergenic
1074046998 10:109848397-109848419 GAGAAAAGGTGGAAGGGGGAGGG - Intergenic
1074064040 10:109996492-109996514 CAAAAATGGGGGAAGGAGGAAGG + Intronic
1074300638 10:112230561-112230583 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074561884 10:114542520-114542542 GAAGAAAGGAAGAAGGAGGAGGG + Intronic
1074615892 10:115067866-115067888 CAGAAAAGAAGGAAGGAAGAAGG + Intergenic
1074722514 10:116274490-116274512 AAGAAGAGGAGGAAGGAGGAGGG + Intergenic
1074799963 10:116990000-116990022 CAGAACAGGCAGAAGCTGGTAGG + Intronic
1074987195 10:118668939-118668961 CAGATGAGGAAGAAGGAGGGTGG + Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076181398 10:128411707-128411729 CAGAAAAGGCAGAAAAGGGAGGG + Intergenic
1076400975 10:130185104-130185126 GAGAAAAGCCAGAAGGAGCTTGG + Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076558756 10:131347220-131347242 GAGATAAGGAAGAAGGAAGAAGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1077941436 11:6847811-6847833 CAAAAAAGACAGAAAGATGAGGG + Intergenic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078845058 11:15113091-15113113 GAGAAAAGAAAGAAAGAGGAAGG - Intronic
1079072901 11:17363563-17363585 AAGAAAAGAGAGAAAGAGGAAGG - Intronic
1079299718 11:19267187-19267209 GAGAGAAGGAACAAGGAGGAGGG - Intergenic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1080005339 11:27400322-27400344 CAAAAAAAGCAGGAGGAGTAGGG - Intronic
1080048932 11:27838586-27838608 GAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080540906 11:33263784-33263806 AACAAAAGACAGAAAGAGGAAGG - Intronic
1080569183 11:33540984-33541006 AAGAAAAGGAAGAATGAGAAAGG + Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1080905951 11:36544857-36544879 CAGAAAAGAGAGAACGAGGGGGG - Intronic
1081710414 11:45212413-45212435 TACAAAAGGGAGAAGGAGGGAGG - Intronic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081762631 11:45587219-45587241 AAGAAAAGGCAGATGAAGTAGGG - Intergenic
1081996959 11:47371911-47371933 CAGAAAATGCAAAAGCAGAAAGG - Intronic
1082065385 11:47894588-47894610 CACAAAAGGCAGAAAAAGTATGG + Intergenic
1082119137 11:48358919-48358941 CAGTAATGGCAGAAGGTGAAGGG + Intergenic
1082809210 11:57468423-57468445 CAGAAGAGGCAGAAGACAGATGG - Intronic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083033333 11:59614740-59614762 GAGATAAGGCAGAAAGGGGACGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083144117 11:60745734-60745756 CAGAAAAGGAAGAAGATAGAGGG + Intergenic
1083179398 11:60974539-60974561 TAGAAAGGGAAGAAGGAGGCTGG - Intronic
1083577170 11:63800635-63800657 AAGAAAAGGAAAAAGAAGGAAGG + Intergenic
1083920168 11:65778180-65778202 CGGGAAAGGCAGAAAGAGGTCGG + Exonic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085084168 11:73655768-73655790 CAGAAACCCAAGAAGGAGGAGGG - Intronic
1085240895 11:75054249-75054271 CTGAAAAGTCAGGAGTAGGATGG - Intergenic
1085930661 11:81079092-81079114 GATAAATGGCAGAAGTAGGATGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086168250 11:83805574-83805596 GACAAAAGGGAGAGGGAGGATGG - Intronic
1086457076 11:86969537-86969559 TTGAAAAGGAAGAAGGAGAAAGG - Intergenic
1086557650 11:88130291-88130313 TACAAAAGACAGAAGGAGAAGGG + Intronic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1086947798 11:92860466-92860488 GAGAGAAGGCAGGAGAAGGAGGG + Intronic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1087732074 11:101790223-101790245 AAGAAGAGGAAGAAGGAGAAAGG + Intronic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1087953946 11:104260157-104260179 TAGAAAAGTCACAAGGAGGAAGG + Intergenic
1088096998 11:106113055-106113077 CAGAAAAGGCAGAGGGTAAATGG - Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088938999 11:114434973-114434995 CAGAAAAGACAGGAAGATGAGGG - Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089089720 11:115861209-115861231 AAGAAAAAGTAGAAGGAGTAAGG + Intergenic
1089196342 11:116695971-116695993 AAGAAAGGAGAGAAGGAGGAAGG - Intergenic
1089528310 11:119110978-119111000 GAGAAGAGGCAGAACGGGGAGGG + Intronic
1089601986 11:119622044-119622066 CAGAAAGCTCTGAAGGAGGAAGG - Intergenic
1089667558 11:120030065-120030087 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
1089763529 11:120746484-120746506 CAGAAAAGGGGGCTGGAGGAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090378699 11:126309886-126309908 CAGAAAAGGCAGAAGAAGAAGGG - Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1090817651 11:130314005-130314027 GAGAAAAAGCAGAAGGGGAAAGG + Intronic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1091025170 11:132135485-132135507 GAGAACAGGCAGAAGGTGTAAGG + Intronic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1091119340 11:133043648-133043670 CAAAAAATGCATGAGGAGGAAGG - Intronic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091182637 11:133620581-133620603 CAGTAAAGGAGAAAGGAGGAAGG + Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091751392 12:3023253-3023275 TAGTAAAGGCAGAAGGAAGTGGG + Intronic
1091888493 12:4033608-4033630 CAGAGAAGGAAAAAGGAGAATGG - Intergenic
1091941225 12:4484465-4484487 AAGAAAGGGAAGAAGGAGAAAGG + Intergenic
1091996304 12:4996785-4996807 GAGAAAAGGGAGGAGGAAGAGGG + Intergenic
1092041208 12:5386203-5386225 CATAAATGGAAGAAGGAGAAAGG - Intergenic
1092174066 12:6390946-6390968 GAGAAAAGGCAGAAGAAGGGGGG + Exonic
1092286259 12:7130653-7130675 CAGAAGGGGCAGCAGCAGGAGGG - Exonic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093772586 12:23034865-23034887 GAGGAAAGGAAGAAGGAGGGAGG - Intergenic
1094050505 12:26215431-26215453 CAGAAAAGGCAGAAATGGGGTGG + Intronic
1094465418 12:30749072-30749094 AATAAAAGGCTGAAGGAGGTTGG + Intronic
1094465812 12:30753601-30753623 CAGATGAGGCTGAAGGAGGTGGG + Exonic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1094818304 12:34206689-34206711 CAGAAAGAGCACAAGGTGGAAGG - Intergenic
1095180751 12:39144779-39144801 CGGGAAAGGCAGTAGGAGGGAGG + Intergenic
1095604629 12:44052392-44052414 CAGAAAAGAAAGAACAAGGAGGG + Intronic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1096016477 12:48280740-48280762 CAGAGAAGGAGGAAGGACGAGGG - Intergenic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096518074 12:52169100-52169122 CAGTAAAGGCGGAAGGTGAAGGG + Exonic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096629693 12:52918113-52918135 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1096806270 12:54143041-54143063 CAAGGAAGGAAGAAGGAGGATGG + Intergenic
1096847719 12:54417347-54417369 TAGAAAAGAGGGAAGGAGGAAGG - Intronic
1097046099 12:56189040-56189062 CAGAAAAGCCAGGAGGGCGATGG + Intronic
1097420203 12:59368341-59368363 GAGAAAGGGCAGCAGGAGGAAGG - Intergenic
1097625430 12:61994373-61994395 TTGAAAAGGCAACAGGAGGAAGG - Intronic
1097800928 12:63913051-63913073 AAGAAGAGGCAGATCGAGGAGGG - Intronic
1097960927 12:65531420-65531442 CAGAAAAGATAGAAGGAATAGGG + Intergenic
1098085766 12:66841246-66841268 AAGAAAAGAGAGAAGGAGAAAGG - Intergenic
1098122549 12:67257061-67257083 CAGAAGAGGCAGAGGAAGGTTGG - Intergenic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098980531 12:76951107-76951129 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1099147429 12:79064225-79064247 AAGAAAAGACTGAAGGAGAAAGG + Intronic
1099205448 12:79721385-79721407 CAGAAAAGGCAGAAGGGGCTAGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099463807 12:82957492-82957514 CTGCAAAGGCAGAAGAAGAAAGG + Intronic
1099595278 12:84655063-84655085 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1099627929 12:85099657-85099679 CATCAAAGGCACAAGGAGTAGGG + Intronic
1100208857 12:92380502-92380524 GAGAAAATGCAGAAAGGGGATGG + Intergenic
1100455176 12:94744795-94744817 CAGAAATCGGAGAAGGGGGAGGG - Intergenic
1100466190 12:94848035-94848057 AAGCAAAGGCAGAAGGAAAATGG - Intergenic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1100759752 12:97794386-97794408 AAGAAAAGGTGGAAGCAGGACGG + Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1101558420 12:105832445-105832467 TAGAAAAGGCCTAAGGTGGATGG + Intergenic
1101560718 12:105855326-105855348 GAGATAAGGCAGAAAGAAGATGG + Intergenic
1101709492 12:107251609-107251631 TAGAAAAAGCAGACGGAAGAAGG - Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102198873 12:111043850-111043872 CAGAAATGGTAGTAGGAGAAAGG + Intronic
1102318645 12:111911805-111911827 CACAAGAGGCTGAAGTAGGAGGG - Intergenic
1102318725 12:111912411-111912433 CAGAGAAGGCAGATAAAGGATGG - Intergenic
1102523866 12:113496954-113496976 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1102548563 12:113674274-113674296 CAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1102554076 12:113714374-113714396 GAGAAAAGGCTCAGGGAGGAAGG + Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102731262 12:115112724-115112746 AAGAAAAGGCAGAAGGAGATTGG - Intergenic
1102915233 12:116747603-116747625 CCGAAATGGCAGCAGGAGGGAGG - Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103367028 12:120390820-120390842 AAGGAAAGGAAGAGGGAGGAAGG + Intergenic
1103367767 12:120395488-120395510 AAGAAAGGAAAGAAGGAGGAAGG - Intergenic
1103373518 12:120437700-120437722 GAGAAAACGCAGTCGGAGGATGG + Intergenic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104092690 12:125529034-125529056 GGAAAAAGGAAGAAGGAGGAGGG - Intronic
1104236906 12:126947692-126947714 GAGAAAAGGAAGAAGGAAGCTGG - Intergenic
1104722153 12:131050545-131050567 CAGTCATGGCAGAAGGTGGAGGG + Intronic
1105061475 12:133155293-133155315 CACAAAGGGCAAAAGGAGTAAGG - Intronic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1105795562 13:23848864-23848886 AAGAAAAGCCAGAAGGAGAGAGG + Intronic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106021950 13:25924107-25924129 CAGACAACGTGGAAGGAGGAGGG - Intronic
1106139759 13:27002332-27002354 CTGAAAGGGCAGAAGGGAGATGG + Intergenic
1106883181 13:34153791-34153813 CAGAAAGGGAAAAAGGAGAAAGG + Intergenic
1107072495 13:36286333-36286355 CAAAAGAGGCAGAAGGTGGTTGG - Intronic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1107597979 13:41983525-41983547 AAGATAAGGAAGAATGAGGAAGG - Intergenic
1107615707 13:42164986-42165008 GGGAAAAGGAAGAAGAAGGACGG - Intronic
1107821044 13:44285994-44286016 CAGAAACTCCAGACGGAGGAAGG - Intergenic
1108144531 13:47463165-47463187 CAGAAAAGGCATAAGAAGGATGG + Intergenic
1108286498 13:48914484-48914506 CAGCAAGGGCAGAAGGAAGCAGG - Intergenic
1108431292 13:50356643-50356665 CACAACAGGCATCAGGAGGAAGG + Intronic
1108662422 13:52599284-52599306 AAAAAAAGGAAAAAGGAGGAAGG + Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1108854630 13:54777249-54777271 GAGAGAAGGAAGAAGGAGGAAGG + Intergenic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109256889 13:60094511-60094533 CAGAAATGGCTAAAGGAGAAGGG + Intronic
1109341363 13:61064672-61064694 CAGTTATGGCAGAAGGAGAAGGG + Intergenic
1109918825 13:69028228-69028250 CAGAAGAGGCAAAAGGAAGGGGG + Intergenic
1110273377 13:73616127-73616149 CAGATCAGGCTGAAGAAGGATGG + Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1112009179 13:95279777-95279799 AAGAGAAGGCAGAAAGGGGATGG + Intronic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112253626 13:97807313-97807335 CAGAAATGACAGAATCAGGATGG + Intergenic
1112295673 13:98184648-98184670 CACCAAAGGCGGAAGCAGGATGG - Intronic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112516777 13:100060042-100060064 CAAAAAAGACAGAAAGAGAAAGG - Intergenic
1112536550 13:100262698-100262720 AAAAGAAGGAAGAAGGAGGAGGG - Intronic
1112626572 13:101111468-101111490 GGGAGGAGGCAGAAGGAGGAGGG - Intronic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113721802 13:112563059-112563081 CAGGAAAGTCCGAAGGGGGAGGG - Intronic
1113738716 13:112696647-112696669 CAGAAGAGACAGGAGAAGGAAGG - Intronic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114270421 14:21097646-21097668 AAGATAAGCCAGAAGGATGATGG + Intronic
1114398341 14:22387167-22387189 CAGAAAAGGCACCCAGAGGAAGG - Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114646604 14:24259622-24259644 CAGAAAGGGCAGGAGGAGGGTGG + Intronic
1114870366 14:26648347-26648369 AAGTAAAGGCAGGAGGAAGAAGG + Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115081866 14:29463001-29463023 AGGAAAAGGCAGAGGAAGGAGGG + Intergenic
1115275644 14:31605993-31606015 GAGAAAAGGAAGAAGGAGAAGGG - Intronic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1116085010 14:40224409-40224431 CAAAAAGGGGTGAAGGAGGAAGG + Intergenic
1116294305 14:43086800-43086822 CAGAAAAGGCAGAGGTAGAGGGG - Intergenic
1116755582 14:48943982-48944004 CAGAAAAGGAAAGTGGAGGAGGG - Intergenic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1117088917 14:52229894-52229916 CAGAAAGGGAAGGAGAAGGAAGG + Intergenic
1118174157 14:63421300-63421322 CAGAGAAGGCAGCACAAGGAAGG + Intronic
1118296054 14:64570770-64570792 CAGAAAAGGGTGAAGATGGATGG + Intronic
1118309592 14:64682587-64682609 CAGCAAAGGCAGGCGAAGGAAGG + Intergenic
1118486753 14:66221684-66221706 GAGAAAAGGGAGATGCAGGAAGG - Intergenic
1118526177 14:66646519-66646541 CAGAACAGCCAAAAGGTGGAAGG + Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118804392 14:69222541-69222563 CAGAAAAGGAAAAAGTAGAAAGG - Intronic
1118998925 14:70863214-70863236 CAATCATGGCAGAAGGAGGAGGG + Intergenic
1119020834 14:71112059-71112081 CAGAAAGGGAAGAAGCAGCAGGG - Exonic
1119036736 14:71236681-71236703 CAGAAAGGGAAGAAGCCGGAAGG + Intergenic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119535334 14:75398412-75398434 CAGAAAAGGAAAAGGGAAGAAGG + Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120617341 14:86723619-86723641 AAGGAAAGGCAGTGGGAGGATGG + Intergenic
1120954764 14:90072100-90072122 CAAAAAAGGCTGGAGGATGAAGG - Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121581431 14:95035060-95035082 CAGAAAAGGCAGCTGCAGCAGGG + Intergenic
1121586923 14:95068924-95068946 AAGAGATGGCTGAAGGAGGAAGG + Intergenic
1121659360 14:95623502-95623524 CAGAAAAAGCAGATGGTGCAGGG + Intergenic
1121991020 14:98557319-98557341 CAGAAAAGGCATCAGGATAAAGG + Intergenic
1122188851 14:100023756-100023778 TAAAAAAGGCAAAAGGAGGCTGG - Intronic
1122355407 14:101120257-101120279 CAGAACAGACAGGAGGAGCATGG + Intergenic
1122515421 14:102305011-102305033 CGGAAAAGAAAGAAGCAGGAAGG + Exonic
1122969344 14:105146160-105146182 CAGAAAGGGCAGGCGGAGCAAGG + Intronic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123196772 14:106624525-106624547 CAGATGAGGCACAAGAAGGAAGG - Intergenic
1123999428 15:25742464-25742486 CAGAAAAGGCAAGGGGAGGCTGG - Intronic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124253382 15:28122094-28122116 CAGAAAAGACAGACCGGGGAGGG + Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124879511 15:33628299-33628321 CAAGAAAGGAAGAGGGAGGAGGG + Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125679072 15:41519620-41519642 GACAAAGGGCAGAAGGAGGGAGG - Intronic
1125886663 15:43234644-43234666 CAGAAGAGGCAAAGGAAGGAGGG + Intronic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1126145012 15:45465903-45465925 CAAAACAGGCAGAAGAAGGAGGG + Intergenic
1126273171 15:46845653-46845675 CAGAAAAGACAGGAGGATGTGGG - Intergenic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127087445 15:55437663-55437685 TATAAAAGGTAGAAGGAGGCAGG + Intronic
1127108802 15:55645906-55645928 CAGAAAGGGAAGGAGGAGAAAGG + Intronic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127260631 15:57324054-57324076 GAGAAAAGGGAGGAGGAGAAAGG + Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128396282 15:67229585-67229607 GAAAAAAGGAGGAAGGAGGATGG + Intronic
1128419481 15:67478086-67478108 CAGAAAAGGCAGACAGAGGCTGG + Intronic
1128441666 15:67715168-67715190 CAGAAAAGGGAGTAAGAGCAGGG - Intronic
1128871843 15:71165101-71165123 CAGAAGAGGAAGAAGGCCGAAGG + Intronic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129450208 15:75647449-75647471 CGGAAAAGGCAGGAGGATGACGG + Intronic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1129648483 15:77461062-77461084 CAGAAAAGCCAGAAGAGTGAAGG + Intronic
1129698466 15:77754129-77754151 GGGAAAAGGGAAAAGGAGGAAGG + Intronic
1129839477 15:78734882-78734904 CAGAAGAGGCTGGGGGAGGAGGG + Intergenic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1130963187 15:88678598-88678620 AAAAAAAGGAAGGAGGAGGAAGG - Intergenic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131025222 15:89135873-89135895 CAGAACAGGAAGAAGGCCGAAGG + Intronic
1131657295 15:94475091-94475113 CAGACAAGGCAAAATGATGAAGG - Intronic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1132050554 15:98604590-98604612 GAGAGAAGGCAGCAGAAGGAGGG + Intergenic
1132184029 15:99788314-99788336 CAGAAAAGGAAAAGGAAGGAAGG - Intergenic
1132195610 15:99912537-99912559 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132977095 16:2716332-2716354 CAGAAAGGAGAGGAGGAGGAAGG - Intronic
1133069143 16:3234418-3234440 GAGAAAGGAAAGAAGGAGGAAGG + Intronic
1133422115 16:5654768-5654790 GAAAGAAGGAAGAAGGAGGAAGG - Intergenic
1133816323 16:9200037-9200059 AAAAGAAGGAAGAAGGAGGAAGG - Intergenic
1134053795 16:11156551-11156573 CTGAAACGGCAGCAGGAGGAAGG - Intronic
1134197544 16:12170524-12170546 AAGCTCAGGCAGAAGGAGGAGGG + Intronic
1134215132 16:12311428-12311450 CAGGAAAGGAGGACGGAGGAGGG - Intronic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1134470778 16:14523737-14523759 CAGAAATGACAGAAGGATTAGGG + Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134829981 16:17315099-17315121 GGGAAAAGGCAGAAGGAGGGAGG + Intronic
1135247395 16:20868796-20868818 AAGAAAAGGCAGAAGAAAGAAGG + Intronic
1135348265 16:21707577-21707599 AAGAAAAGGAAGGAGAAGGAAGG - Intronic
1135491139 16:22910787-22910809 CAGGAAAGGTAGAAGGGGAAGGG + Intronic
1135543351 16:23349073-23349095 AAGAAAGGGAAGAAGAAGGAAGG - Intronic
1136014173 16:27384173-27384195 CAGAATTGGCTGAAAGAGGAAGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136360282 16:29775013-29775035 AAGAAGAGGCAGAAGGAAAAAGG + Intergenic
1136479630 16:30533447-30533469 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136483408 16:30556406-30556428 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136698700 16:32111958-32111980 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1136768904 16:32815871-32815893 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1136938465 16:34498862-34498884 GAGAAAAGAAGGAAGGAGGAAGG - Intergenic
1136961354 16:34849695-34849717 GAGAAAAGAAGGAAGGAGGAAGG + Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137658853 16:50185725-50185747 AAGAAAAGAGAGAGGGAGGAAGG - Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137966570 16:52940055-52940077 CAGAAAAGGGAGAAGGCCTATGG - Intergenic
1138217222 16:55214757-55214779 GAGAAAAGGAGGGAGGAGGAAGG + Intergenic
1138231523 16:55340516-55340538 CACATGAGGCAGAAGGAGTAGGG + Intergenic
1138367379 16:56491416-56491438 CAGAAAAGGTCAAAGGAGAAGGG - Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1139015096 16:62680010-62680032 AAGAAAAGGCTGAGGGTGGATGG + Intergenic
1139173658 16:64662298-64662320 GAGAAAAGGAAGAAGTAGGGAGG - Intergenic
1139206798 16:65036910-65036932 GACAAAAGGCAGAAAGAAGATGG + Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140711482 16:77682258-77682280 CTCAAAAGGCCGAAGCAGGAGGG + Intergenic
1140765752 16:78155215-78155237 AAGAAAGGAGAGAAGGAGGAAGG + Intronic
1141127920 16:81414388-81414410 GAGACCAGGCAGAAGGAGGTTGG - Intergenic
1141427140 16:83951880-83951902 GAGAGAAGGAGGAAGGAGGAAGG - Intronic
1141802712 16:86322131-86322153 AAGAAAAGGGAAAAGAAGGAAGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1142008200 16:87700451-87700473 CAGATAAGGCGGAGGGAGGAGGG + Intronic
1203071321 16_KI270728v1_random:1077982-1078004 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142572798 17:886067-886089 CACAAAAGGCACAAAGAGGCTGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1142958162 17:3535196-3535218 GACAGAAGGGAGAAGGAGGAGGG - Intronic
1142975703 17:3642750-3642772 CAGCAAGGGCAGAATGAGGTTGG - Intronic
1142980303 17:3667771-3667793 TAGACTAGGCAGAGGGAGGAAGG - Intronic
1143083156 17:4396431-4396453 CAAAGAAGGCACAAGGAGGCCGG + Intergenic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1143982286 17:10880328-10880350 CAAAAAAGGCTGAAGGATGCTGG + Intergenic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1144628225 17:16856424-16856446 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1144724012 17:17492328-17492350 CTGAAATGCCAGAAGGGGGAAGG - Exonic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1145159817 17:20566991-20567013 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1145692853 17:26762208-26762230 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1145763284 17:27440334-27440356 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1145764291 17:27447812-27447834 GAGAAAGGGCAGAAGCTGGAAGG + Intergenic
1145901464 17:28493194-28493216 CAGAGAAGGCAGAGGAGGGAAGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146139966 17:30357266-30357288 CTGAGAAGGCAGCAGGGGGATGG + Intergenic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1147319915 17:39639883-39639905 CAGAAAAGCCACAGGGAGGAGGG - Intronic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147492187 17:40879987-40880009 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1148180709 17:45602580-45602602 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148268194 17:46243346-46243368 AAGAAAAGAAAGAAGAAGGAAGG + Intergenic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148615174 17:48996198-48996220 CAGGAACGGCGGGAGGAGGAGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148789050 17:50162964-50162986 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1148789058 17:50162994-50163016 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1148923402 17:51060521-51060543 AAAAAAAGGCAGAAGAAGGTAGG + Intronic
1149336332 17:55640099-55640121 GAGAAAAGACAGCAGGAGAAAGG - Intergenic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149614122 17:57983871-57983893 CAGAAAACTCAGATTGAGGAAGG + Intronic
1149747834 17:59116496-59116518 CAGAAAAGGAGGTAGGAGAAAGG - Intronic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150579451 17:66458864-66458886 AAGCAAAGGCAAAAGGGGGAAGG + Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150647031 17:66985143-66985165 CAGATAAGGCAGGATGAGGGCGG - Intronic
1150677836 17:67259937-67259959 AAGAAAAGAAAAAAGGAGGAGGG + Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1151521092 17:74630231-74630253 CAGAAAATGCAGATGGTGGCCGG + Intergenic
1152033900 17:77859943-77859965 CCAACAAGACAGAAGGAGGAAGG - Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152945931 17:83197318-83197340 CAGAAAAAGCAGCAGGCGGTTGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1153833880 18:8947326-8947348 AAAAAAAGGCAGAAGGAGGCTGG + Intergenic
1153993666 18:10421736-10421758 CAGAAAAGTCAGACAGAGAAGGG - Intergenic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1155011419 18:21782459-21782481 CAGAAAAAGCAGTAGTAAGAGGG - Intronic
1155996692 18:32338102-32338124 CAAAAAATGCAGACGGAGGAAGG + Intronic
1156089508 18:33448890-33448912 CAGAAAAGGCAGAAACAGAGGGG + Intergenic
1156197423 18:34790954-34790976 GAGAATAGGCAGCGGGAGGATGG + Intronic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1156512040 18:37645473-37645495 CAGAAAAGGAAGAGAGAGAATGG + Intergenic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156746009 18:40392167-40392189 CAGATCAGGCAGAAGGGAGAGGG - Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157180661 18:45495190-45495212 AAGAAAAGACAGACAGAGGAAGG + Intronic
1157300476 18:46475240-46475262 ACCAAAAGGCAGGAGGAGGAGGG + Intergenic
1157319749 18:46624812-46624834 GAGAAAAGACAGAAGAAGAAAGG - Intronic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1158091170 18:53715406-53715428 AACAAAAGGAGGAAGGAGGAAGG + Intergenic
1158095319 18:53763636-53763658 CAAAAAAGGTAGAAAGAGGAAGG + Intergenic
1158312394 18:56171908-56171930 CAGAAAAGGCAAAAACAGGTTGG - Intergenic
1158426042 18:57340422-57340444 GTGAAAAGGCAGAAGGAGCTGGG - Intergenic
1158611100 18:58941849-58941871 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1159258663 18:65981194-65981216 AAGGAAAGGCAGAAAGAGAAAGG - Intergenic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159737338 18:72115769-72115791 AAGAAAGGAAAGAAGGAGGAAGG - Intergenic
1159754323 18:72345177-72345199 AATAAATGGCAGAATGAGGAAGG + Intergenic
1160032804 18:75277708-75277730 CAGTAATGGCAGAAGGAGGTAGG - Intronic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160264981 18:77334624-77334646 GAGCAAAGGCCAAAGGAGGATGG - Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1161373972 19:3929431-3929453 CAGCCAAGCCAGCAGGAGGAGGG + Intergenic
1161558869 19:4959663-4959685 AAGAAAGGGGAAAAGGAGGAAGG - Intronic
1161667483 19:5586037-5586059 CAGAACCGGCAGTTGGAGGAGGG + Intergenic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1161988097 19:7668936-7668958 CAGTAAGGGCTGGAGGAGGAAGG - Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162157794 19:8691439-8691461 CAGAAAGGGAAGAGGGAGGGAGG - Intergenic
1162248038 19:9419250-9419272 AAGAAAAGACAGAAGTAGAAAGG - Exonic
1162729997 19:12712711-12712733 CATACAAGGCAGAAGGGGCAGGG - Intronic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164858646 19:31545021-31545043 GAGAAAGAGAAGAAGGAGGAGGG - Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165026988 19:32969459-32969481 CATGAATGGCAGCAGGAGGAAGG - Intronic
1165164244 19:33840338-33840360 CAGTAAAGGCAGGAGGTGAAAGG + Intergenic
1165253708 19:34559774-34559796 CAGAAAAGGCAGGACTGGGATGG + Intergenic
1165272548 19:34723455-34723477 CAGAAAAGGCAGGACTGGGATGG - Intergenic
1165326956 19:35119425-35119447 AGGAAAAGGCAGACGGGGGATGG - Intronic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1165786970 19:38467428-38467450 CAGAAAAGTCAGAGAGAGGCAGG - Intronic
1165986563 19:39774484-39774506 GGGAAAAGGCAGGAGGATGAGGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166503284 19:43356185-43356207 CACCAAAGCCAGCAGGAGGAAGG + Intronic
1166507170 19:43378576-43378598 CACCAAAGCCAGCAGGAGGAAGG - Intergenic
1166553953 19:43685807-43685829 CAGAAAAGAAAGAAAGAGAAGGG + Intergenic
1166672423 19:44718931-44718953 AAGAGAAGGGAGTAGGAGGAGGG + Intergenic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167065709 19:47184381-47184403 CAAAAAAGACAGAATGAGGTAGG - Intronic
1167139215 19:47638113-47638135 AAGAAAGAGCAGGAGGAGGAGGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167459361 19:49616117-49616139 AAGAAATGGCTGAAGGAGGCAGG + Exonic
1168009354 19:53518138-53518160 CACAGAAGGCAGAAGAAGGTGGG + Intergenic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925265641 2:2564599-2564621 CAGTAAAGGCAGCAAGAGGAAGG - Intergenic
925304888 2:2841018-2841040 CAGAGAAGGCATATGGAAGAGGG + Intergenic
925319975 2:2957467-2957489 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
925437908 2:3857163-3857185 CAGCAAAGGCAGAAGACAGAGGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925592396 2:5523267-5523289 GAGAAAAGAGAGAAGTAGGAAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925732430 2:6928883-6928905 CAGAAGTGGCAGGAAGAGGATGG - Intronic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926799247 2:16644751-16644773 CCGCAAAGGTAGAAGAAGGAAGG - Intronic
926828382 2:16932768-16932790 CAGAAAAGGGGGAAGAGGGAAGG - Intergenic
927504307 2:23603246-23603268 CAGAAAAGGCAGCCAGAGGTAGG + Intronic
927657847 2:24966258-24966280 CAGAAAAGACAAAAGGGGAAAGG + Intronic
927946338 2:27137365-27137387 GAGAAAAGGCCGAAGGAAGCAGG - Exonic
928019304 2:27689446-27689468 CAGCAAAGGGAGAAGGAACATGG + Intronic
928781895 2:34833350-34833372 GAGAAAAGGTAGAAAGAAGAAGG + Intergenic
928822470 2:35378090-35378112 CAATAAATGCAGAAGGAGTAAGG - Intergenic
929072206 2:38043575-38043597 CAGAGAAGGCAGAAGAAGAGGGG - Intronic
929072652 2:38049243-38049265 AAGAAAAGGGAGTAGAAGGAAGG + Intronic
929311658 2:40432811-40432833 CAGAAAAGACTGAAGGGGCAAGG + Intronic
929367320 2:41175642-41175664 AAAAAAAGGAAGAAGGAGAAAGG + Intergenic
929448952 2:42023914-42023936 CAGAAAAGAAAGAATGAGGAAGG + Intergenic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
930235064 2:48880911-48880933 CATAAAAGGCGGGAGGAGGCAGG + Intergenic
930334402 2:50027299-50027321 GAGAAAAGGAAGGAGAAGGAAGG - Intronic
930716088 2:54595478-54595500 CAGAAAAGGTAAACGGAGAATGG + Intronic
931102421 2:59017387-59017409 CAGAAAAGGGGAAAGGAGGGAGG + Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
931526827 2:63165805-63165827 AAGAAATGGCAGAGGGAGGAAGG - Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
931665750 2:64608885-64608907 AAAAAAAGACAGAAGAAGGAAGG + Intergenic
932090082 2:68798753-68798775 CAGAAAAGGGGGAAGCAGAATGG + Intronic
932170215 2:69548545-69548567 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932467110 2:71931012-71931034 AAGAGAAGGCAGGAGGAGAAAGG + Intergenic
932840830 2:75080949-75080971 TAGAAAAGACAGAATGAGAATGG + Intronic
932857629 2:75253873-75253895 TAGAAAAGACAGAAGAAGGTTGG - Intergenic
932882181 2:75513029-75513051 CAAAAAAGGCAGAAAATGGAAGG - Intronic
933011117 2:77064831-77064853 CAGAAAAGGCAGAGAAAGCAGGG - Intronic
933180631 2:79222643-79222665 AAAAGAAGGCAGGAGGAGGAAGG - Intronic
933231071 2:79808263-79808285 AGGAGAAGGGAGAAGGAGGAAGG + Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933855698 2:86412150-86412172 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
934564337 2:95330126-95330148 GAGAAGAGGCAGGAGCAGGAAGG + Intronic
934729785 2:96649345-96649367 CAGAAAAGGATGCAGGAGGGTGG - Intergenic
934887624 2:98038816-98038838 TAGAAAAGAAAGAAGGAGGCCGG - Intergenic
935231179 2:101098056-101098078 CAGAGAAGGCAGAAAAAGAAAGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935469646 2:103442965-103442987 CACTAAAGGCTGGAGGAGGAAGG + Intergenic
935548284 2:104423894-104423916 CAGAAAACGCATAAGGAAGAAGG - Intergenic
935760855 2:106319386-106319408 GAGAAATGGCGGAAGCAGGAAGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936658225 2:114513009-114513031 AAGAAAAGGAGGAAGGGGGAGGG + Intronic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936963639 2:118103949-118103971 CAGAGAAGGTAGAAAGGGGAAGG - Intronic
937062779 2:118992696-118992718 AAGGAAAGGAAGAAGGAGAAAGG - Intronic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937843859 2:126555674-126555696 TAGAGAAGGAAGAAAGAGGAAGG + Intergenic
938070108 2:128303942-128303964 CAGAACAGGAAGGTGGAGGAAGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939427376 2:142056813-142056835 AAGATATGGGAGAAGGAGGAAGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939728702 2:145754874-145754896 AAGAAAAGGCAGAAAATGGATGG - Intergenic
939836916 2:147140976-147140998 CAGAAAAGGCAAAAGTATAAGGG + Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940164921 2:150760473-150760495 CTGAAAAGGACTAAGGAGGAGGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940742955 2:157532821-157532843 CAGAAAAGGAAGAGGAAGGAAGG - Exonic
940912288 2:159219193-159219215 TGGAAAATGCAGCAGGAGGATGG + Intronic
941325008 2:164103530-164103552 AAGACAAGGAAGAAGGGGGATGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941474871 2:165938707-165938729 CAGAAAAGGCAGGAAGAAGGAGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941778367 2:169417329-169417351 CAGAAAATTCAGAGGGAGGGAGG + Intergenic
941827480 2:169916587-169916609 GAGCCAAGGCAGAATGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942218922 2:173750326-173750348 GATTAAAGGCAGAAAGAGGAAGG - Intergenic
942305382 2:174601954-174601976 AAGAAGAGGCAGAAGAAAGAGGG + Intronic
942388770 2:175470147-175470169 CAAAAAAGAGAGGAGGAGGAGGG - Intergenic
942462718 2:176179373-176179395 GAGAGAAGGCTGAAGGAAGAGGG - Intergenic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943338397 2:186646608-186646630 AAGAAAGGGAAGAATGAGGAAGG - Intronic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943971844 2:194419794-194419816 CATCAAGGGCAGAAGTAGGAAGG + Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
944364277 2:198898264-198898286 AAGAAAAGAGAGAAGAAGGAAGG + Intergenic
944853613 2:203744848-203744870 CAGTCATGGCAGAAGGGGGAAGG - Intergenic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945420000 2:209623284-209623306 TAAAAAAGGCAGCAGCAGGATGG + Intronic
945685248 2:212960971-212960993 GAGACAAGGAAGAGGGAGGAAGG + Intergenic
945717039 2:213370056-213370078 TAGAAAAGTAGGAAGGAGGAAGG - Intronic
945874178 2:215260588-215260610 AAGAAAAGGCAAAAAGAGAATGG + Intergenic
946147196 2:217739950-217739972 CAGAAAGGGCAGGAGAAGAAGGG - Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946237354 2:218332365-218332387 CAGAAAGAGAAGAAGCAGGATGG + Intronic
946239787 2:218346486-218346508 CAGACAAGGCAGGAGGAGCAGGG - Exonic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946456784 2:219832940-219832962 GAGAAAAGGAGGCAGGAGGAGGG + Intergenic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946714566 2:222539677-222539699 CAGAAACAGCAGGAGGAAGATGG + Intronic
946817831 2:223597465-223597487 AAGAAAAGGCAGAAAAGGGAAGG - Exonic
946823664 2:223655160-223655182 CAGAAAAGGGAGAAAGAATAGGG - Intergenic
946907578 2:224431187-224431209 GAGAAAATGCAGAAGAAGGAAGG + Intergenic
947461997 2:230311503-230311525 AAGAAAAGGCTGAATGAGCACGG + Exonic
947471081 2:230401715-230401737 AAGAAAAGGCTGAATGAGCACGG + Exonic
947777152 2:232722287-232722309 CAGTCATGGCAGAAGGAGAAGGG + Intronic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948402485 2:237693703-237693725 CATAGATGGCAGGAGGAGGATGG + Intronic
948435732 2:237952788-237952810 CAGAAAAGAAAGAAAGAGAAAGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948755198 2:240155380-240155402 CCAAAAAGTCAGAGGGAGGAGGG - Intergenic
948783091 2:240336969-240336991 GAGCAAAGCCAGAAGGATGAAGG + Intergenic
948960871 2:241335805-241335827 CAGAGAAGTCAGAAAGGGGAAGG - Intronic
1168845303 20:940390-940412 CAGCAAAGGCAGAGGGTGGGAGG + Intergenic
1168977427 20:1978007-1978029 TAGAAAATGCAGAGTGAGGAAGG - Intergenic
1169006765 20:2213718-2213740 AAGAAATGGGAGAGGGAGGAAGG + Intergenic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169147411 20:3261931-3261953 CAGAAAATGTGGAAGGAGGGTGG + Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169268802 20:4183459-4183481 CAGAAAAGCCAAGAGGAGGGAGG - Intronic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169393066 20:5205882-5205904 CAGCAAAGGCAGAGGCAGGGCGG + Intergenic
1169567326 20:6869274-6869296 CCGAAAGGGCAGAAGTTGGAGGG + Intergenic
1169730032 20:8776867-8776889 CAGAAATGGGAGAATAAGGAGGG + Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170371127 20:15649136-15649158 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170915883 20:20625033-20625055 CAGAAAAGCAAGAGGGAGGGAGG - Intronic
1171106874 20:22442036-22442058 AAGAAATGGTAAAAGGAGGAAGG + Intergenic
1171226484 20:23445862-23445884 CAGCAAAGGCAAAAGGTGCATGG + Intergenic
1171447921 20:25217746-25217768 CATTAAAGGATGAAGGAGGAGGG - Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171782703 20:29435510-29435532 TAGAGATGGCAGAAGGATGAGGG + Intergenic
1171997083 20:31739754-31739776 CAGAAACTGAGGAAGGAGGAAGG + Intronic
1172098398 20:32471858-32471880 CAGACATGGCAGAAGGTGAAGGG - Intronic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172358950 20:34298994-34299016 CATATAAGGCAGAAGGGGCAGGG - Intronic
1172468395 20:35173872-35173894 CAGAAAAGGCAGCAGGGGCCAGG + Intronic
1172493749 20:35362973-35362995 AAGAAAAGAAAGAAGGGGGAAGG - Intronic
1172595928 20:36151183-36151205 CAGGAAAGCCAGGAGGAGAACGG - Intronic
1172808053 20:37627324-37627346 CAGAAAAGGCAGGGGGGAGAGGG - Intergenic
1173013240 20:39201300-39201322 CAGAAATGCCTGATGGAGGAAGG - Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173239048 20:41277078-41277100 CAGACAAGACAGCATGAGGAAGG + Intronic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174015015 20:47480895-47480917 AAGAAAGGAAAGAAGGAGGAAGG - Intergenic
1174112463 20:48205895-48205917 CAGAGAAGGAGGGAGGAGGAGGG - Intergenic
1174168773 20:48603624-48603646 CAGAGAAGGAGGGAGGAGGAGGG + Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1174992980 20:55534186-55534208 AAGAAAAGGAAGAAGGTGGCCGG + Intergenic
1175035828 20:56000969-56000991 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1175149136 20:56919334-56919356 GAGAAAAGGCAGATGCAGAAAGG - Intergenic
1175233154 20:57488711-57488733 CAGAACAGGAAGAAGGCCGAAGG + Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175298817 20:57928537-57928559 GAGAAAAGGGAGGAGGAAGAGGG - Intergenic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1175659664 20:60801829-60801851 CAGAAAAGGCAGCAGGAATGAGG + Intergenic
1175706980 20:61186667-61186689 TGGAAAAGGCAGGAGGATGAGGG - Intergenic
1176293372 21:5058129-5058151 CAGAAAACCCAGAAGGGAGATGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177412446 21:20747719-20747741 CAGTAAAGTCAGAGTGAGGAAGG - Intergenic
1177670210 21:24214739-24214761 AAGAAAAGAGAGAAGGGGGAGGG + Intergenic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1178006370 21:28225223-28225245 AAGAAAAGGGAAAGGGAGGAAGG + Intergenic
1178027208 21:28481841-28481863 CAGAAAAGCCAAAAGGACAAAGG - Intergenic
1178145030 21:29729303-29729325 CAGAAAAGTCAAAAAAAGGAAGG + Intronic
1178185835 21:30219131-30219153 CAGAAAAGCCCGAGGGAGGGTGG - Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178845330 21:36169756-36169778 AAGAAATGGCAGGATGAGGATGG - Intronic
1179053191 21:37906818-37906840 AAGAGAGGGCAGAAAGAGGACGG - Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179162772 21:38911532-38911554 AGGAAAAGCCAGAGGGAGGATGG - Intergenic
1179262806 21:39773458-39773480 AAGAAAAGGAAGAAAGGGGAGGG - Intronic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179863888 21:44205519-44205541 CAGAAAACCCAGAAGGGAGATGG - Intergenic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1180150743 21:45946019-45946041 TACAGAAGGCAGAAGCAGGAGGG - Intergenic
1180618394 22:17143746-17143768 CAGAAAGCGCTGGAGGAGGAAGG + Intronic
1180703342 22:17793740-17793762 CAGCAAGGGCAGAAGGAGAGAGG + Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181419628 22:22788866-22788888 AAGGAAAGGCAGAGGGAGAAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181735713 22:24879918-24879940 CAGAAAGAGCAGAAAGAGTAAGG + Intronic
1181829050 22:25544630-25544652 CTGAAAAGGCAGTGGTAGGATGG + Intergenic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1181951985 22:26560820-26560842 CAGAACAGGAAGAAGGCCGAAGG - Intronic
1182089083 22:27581791-27581813 CAGAAGAGGCAGAGGGAGCGCGG + Intergenic
1182270808 22:29152193-29152215 CAGCAAAGACTGCAGGAGGATGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183144709 22:35979515-35979537 CAGAAAAGGCACAATGAAAAAGG + Intronic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183426831 22:37744560-37744582 CAGAAAAGCCTGGAGGAGGCTGG + Intronic
1183679107 22:39316782-39316804 AAGAAATGGCAGGATGAGGATGG - Exonic
1183889600 22:40915698-40915720 CAGAATAGCCAGAAAGATGAAGG + Intronic
1184263122 22:43330962-43330984 CAGGAAAGGCAGTAGGCGGTGGG - Intronic
1184846208 22:47089063-47089085 CAGAGAAGCAAGAAAGAGGAGGG + Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185220213 22:49625687-49625709 CAGAGAAGGCAGAAAAAGAATGG + Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949114323 3:301416-301438 CAGAACAGCCAGTAGGAGGTTGG - Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949247549 3:1942780-1942802 AACAAAAGAAAGAAGGAGGAGGG + Intergenic
949486998 3:4549529-4549551 AAGAAAAGGGGAAAGGAGGAAGG - Intronic
949512081 3:4775191-4775213 GAGCAAAGGCAGAGGGAAGAGGG - Intronic
949723006 3:7012512-7012534 AGAAAAAGGCAGAAGCAGGAAGG + Intronic
949900270 3:8808531-8808553 CACAAAAGCTAGAAGGAAGAAGG + Intronic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950352470 3:12369940-12369962 GAGAAAATGCAGGAGGAAGAAGG - Intronic
950823140 3:15784576-15784598 CACAGAAGGCAGAAGAAGAATGG + Intronic
951412534 3:22382113-22382135 CAGAAGAGGAAGAAGGCCGAAGG - Intergenic
951591451 3:24269908-24269930 CAGAAAAAGCCAAAGAAGGAAGG - Intronic
951657417 3:25025339-25025361 CAGACAAGTCAAAAGGAGAAGGG - Intergenic
952069289 3:29614297-29614319 CGCAAAAGGCTGAAGGAGGGTGG + Intronic
952169488 3:30791241-30791263 CTGAAAAGGGAGAAAAAGGATGG - Intronic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953386412 3:42508733-42508755 GAGAAAAGGTGGGAGGAGGAAGG - Intronic
953549116 3:43886747-43886769 CAGAAAGGGCAGAAGGCAAAGGG + Intergenic
953784158 3:45897755-45897777 CAGACAAGGAAGAAAGAAGAAGG - Intronic
953811920 3:46120093-46120115 GAGAGAAGGCTGAAGGAGGAAGG + Intergenic
953862010 3:46552572-46552594 GAAAGAAGGCAGGAGGAGGATGG - Intronic
953974492 3:47371783-47371805 AAGAGAAGGCAAAAGGGGGAAGG - Intergenic
954076500 3:48185715-48185737 CACAAAAGGCAGCAGGGTGAAGG + Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
955887234 3:63613474-63613496 GAGAGAAGGAAGAAGGAGGGAGG + Intronic
955935217 3:64096497-64096519 CAGAGAATGCTGAATGAGGAAGG - Exonic
955993192 3:64650509-64650531 GAGAAAAGGGAGAGGGAAGAGGG + Intronic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956235696 3:67068754-67068776 CAAAAATGGCAGAAGGTGAAAGG + Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956860550 3:73319540-73319562 CAGAAAAGACAGTAGAAGAAGGG + Intergenic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957274103 3:78068170-78068192 AAGAGAAGGCAGAAGGCAGAAGG + Intergenic
957310459 3:78511936-78511958 TAGAAAAGCAAGAAGGAGAATGG - Intergenic
957418900 3:79942799-79942821 CAGAAAATACTGAAGGAGGTAGG - Intergenic
957422903 3:79994860-79994882 CAGAAATATCAGAAGGAGCATGG - Intergenic
957541265 3:81572177-81572199 CAGTCAAGGCAGAAGGTGAAGGG - Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958121375 3:89293674-89293696 CAGAAAAGAGAGAAAGAGCAAGG - Intronic
958981567 3:100726287-100726309 CAAAACAGGCAGAAGAAGGTAGG - Intronic
959002529 3:100981404-100981426 GAGAGAAGGGAGAAAGAGGAGGG + Intronic
959063126 3:101633708-101633730 CAGAAAAGGCAGGATGCGGAAGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959684630 3:109130958-109130980 CAGCAAAGGGATATGGAGGAAGG - Intergenic
959912542 3:111779806-111779828 TAGCAAAGGCAAAAAGAGGATGG - Intronic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960246370 3:115404603-115404625 AAGAAAAGAAAGAAGGAGGGTGG + Intergenic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960418334 3:117412670-117412692 GAGAAGAGGAAGAAGGAGAAGGG - Intergenic
960593362 3:119386721-119386743 GATACAAGGCAGAAGGAGCAGGG + Intronic
960741627 3:120840299-120840321 AAGACATGGCTGAAGGAGGAAGG + Intergenic
961589859 3:127970726-127970748 CAGAAAAGGCAGATGGATAGAGG + Intronic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
962055815 3:131870596-131870618 AAGAAAAGGAGGAAGGAGAAGGG - Intronic
962324541 3:134422511-134422533 CAGTAATGGCAGAAGGGGAAAGG - Intergenic
962346569 3:134623417-134623439 TAGAGAAGGCTGAAGCAGGAGGG - Intronic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962494434 3:135924900-135924922 CAGTTAAGGCAGGAGGAGAAAGG - Intergenic
962959147 3:140293878-140293900 TAGGAAAGGTGGAAGGAGGATGG - Intronic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
963116575 3:141735424-141735446 AAGGAAAGGGAGAAGGAGAAAGG - Intergenic
963181603 3:142362656-142362678 AAGAAAAGGCCGGAGCAGGAGGG - Intronic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
963931080 3:151004877-151004899 AAGAAAAGACAGAAAGAAGAGGG - Intergenic
964034977 3:152184589-152184611 AAAAAAAGGTGGAAGGAGGAGGG - Intergenic
964138995 3:153376741-153376763 AAGAAAAGGCTGAAGTGGGAGGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964431391 3:156610315-156610337 CAGGAAAGGCAGAAAGAGTCTGG + Intergenic
965498933 3:169433543-169433565 AAGAAAAGAAAGAAAGAGGAAGG + Intronic
966264451 3:178022303-178022325 AAGAAAAGACAGGAGAAGGAGGG - Intergenic
966396327 3:179507405-179507427 AAGGAAGGGAAGAAGGAGGAAGG + Intergenic
967068057 3:185938091-185938113 GAGGAAAGGCAGAGCGAGGAGGG - Exonic
967473622 3:189890772-189890794 AAGAAACTGCAGAGGGAGGAGGG - Exonic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
967760214 3:193215551-193215573 TAGAAAAGGCAGGTGGAAGAAGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968441702 4:627693-627715 CAGAAAAGGAGGGAGGAGGGTGG - Intronic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969053607 4:4388305-4388327 CACAAAAGGAACAAAGAGGAAGG - Intronic
969202393 4:5616300-5616322 CAGAAAGGGCTGAAGGAAGAGGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969495190 4:7522630-7522652 GAGAAAAGGAGGGAGGAGGAGGG - Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970023663 4:11597038-11597060 CAGACAAGTCTGAAAGAGGAAGG - Intergenic
970275789 4:14399156-14399178 TAGAAAAGGCAAAAGACGGAGGG + Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970586289 4:17517601-17517623 CTAAGAAGGAAGAAGGAGGAAGG - Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971034254 4:22675880-22675902 CACAAAAGGCAGAATGGGTAGGG + Intergenic
971035575 4:22689329-22689351 CAGTCATGGCAGAAGGATGAAGG - Intergenic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971769829 4:30882107-30882129 GAGAAACGGGAGGAGGAGGAGGG - Intronic
971912454 4:32811257-32811279 CAAAAATGGCAGAAGGGGAAGGG + Intergenic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
972213682 4:36870131-36870153 CAGAAAAGGGAGAGAAAGGAGGG + Intergenic
972287542 4:37663204-37663226 CAAAAATAGCAAAAGGAGGAGGG - Intronic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
972776097 4:42242020-42242042 AACAAAAGGCAGAAGGAGGGAGG + Intergenic
972942786 4:44217664-44217686 CAAAACAGGCAGAAGAAGGTGGG + Intronic
973234241 4:47880945-47880967 TGGAAAAGGTAGAGGGAGGAGGG + Intronic
973857828 4:55031222-55031244 CGGCAAAGGCAAAAGGAGGTGGG - Intergenic
973980411 4:56304077-56304099 GAGAAGAGGCAGAGGGAGGGAGG - Intronic
974103279 4:57440581-57440603 TAAAAAAGGTAGAAGGAGGAAGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974543934 4:63275671-63275693 CAGAAATGGCAGCAGCATGACGG - Intergenic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975176292 4:71293265-71293287 CATAAAATCCAGAAGGAGGCTGG + Intronic
975431000 4:74290749-74290771 CAGAAAAGTAATGAGGAGGATGG - Intronic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976116422 4:81733139-81733161 CCCAAAAGGCAGAAGGAGCGTGG + Intronic
976132981 4:81904631-81904653 CACAAAAGGAAGAAGTAGCAAGG - Intronic
976448191 4:85156098-85156120 CAGGAAAGGAGGAAGAAGGAAGG + Intergenic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
977287018 4:95120658-95120680 AAGAAAAGAAAGAAGAAGGAAGG - Intronic
977448148 4:97158250-97158272 AAAAAATGGCAGAAGTAGGAAGG - Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
978059030 4:104312925-104312947 CAGAAAAAGCAGAACTAAGAGGG + Intergenic
978124914 4:105123973-105123995 CAGAAAAGGTTGGAGAAGGAGGG - Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
978973044 4:114834133-114834155 CAAACAAGACAGAGGGAGGAGGG + Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979521666 4:121674328-121674350 AAGAAAAGGAAAAAGGAGAAAGG + Intronic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980223574 4:129951137-129951159 AGGAAAAGACAGAAGGAGGGAGG + Intergenic
980394242 4:132188928-132188950 CTAAAAAGGAAGAAGGAGCAGGG - Intergenic
980706661 4:136505343-136505365 CACAGAAGGCAGATGGAGTAGGG + Intergenic
980732283 4:136838379-136838401 CAATCAAGGCAGAAGGAGAAGGG - Intergenic
980875415 4:138657497-138657519 GAGAGAGGGCAGAAGGAGCAGGG - Intergenic
980948406 4:139346870-139346892 CAGAAAAGGTAGAAGATAGAGGG + Intronic
981185776 4:141801200-141801222 CTGAAATGGCGGAAGGTGGAAGG + Intergenic
981351154 4:143731251-143731273 TAAAAAAGACAGAAGGAGTAAGG + Intergenic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981588058 4:146325958-146325980 CACAAAAAGCAGCAGGAGCAGGG + Exonic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981831896 4:149011359-149011381 CAGAACAGACAGAAAGAAGAAGG + Intergenic
981925717 4:150137311-150137333 TGGTAAAGGCAGAAGCAGGAGGG + Intronic
982050737 4:151498882-151498904 CAGAAAAACAATAAGGAGGAAGG - Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982130428 4:152224281-152224303 TAGAGAAGGCAAAAGGTGGAGGG + Intergenic
982172822 4:152678427-152678449 TAGAAGAGGTGGAAGGAGGATGG + Intronic
982483583 4:155940316-155940338 CAGAAAAGGCAGAAGAGAGTAGG + Intronic
982649763 4:158073143-158073165 AAGAAAAGAAAGAAAGAGGAGGG + Intergenic
982829337 4:160041797-160041819 AAAAGATGGCAGAAGGAGGAAGG + Intergenic
983205311 4:164904888-164904910 AAAAAAAGACGGAAGGAGGAAGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983357750 4:166685538-166685560 GGTAAAAGGCAGTAGGAGGATGG - Intergenic
983552567 4:169032466-169032488 AGGAAAAGGAAGAAGGAAGAGGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984250234 4:177323242-177323264 CAGAAAAGACAGAATGAGATTGG - Intronic
984290658 4:177789747-177789769 GAGAAAAGGGAGAATAAGGAGGG + Intronic
984339052 4:178430187-178430209 GAGAAAACGCAGATGTAGGAAGG - Intergenic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984749181 4:183255217-183255239 CAGAAAAGCCAGAACAAGAAGGG - Intronic
984797048 4:183671399-183671421 CTGAAAAGGCTGGAGGAGAAAGG + Intronic
984803297 4:183733779-183733801 CAGAAAAGGAAGAAAGGGGAAGG - Intergenic
984829296 4:183956814-183956836 CATAAAATGCAAAAGGAGGTTGG - Intronic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
984863729 4:184262968-184262990 CAGAAAAGTCAGAAGAATTAGGG + Intergenic
985228381 4:187787897-187787919 CAAAAAAGGCAGTGGGAGAAAGG - Intergenic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986035908 5:3938987-3939009 CACAAAAGGCAGAAAAAGTATGG - Intergenic
986037606 5:3955058-3955080 AAGAATAGGAAGAAGAAGGAAGG - Intergenic
986310575 5:6547827-6547849 AAGAAAAGGAAGAGGGAGGCAGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986636048 5:9823560-9823582 CAGAAAGGGGGGAAAGAGGAAGG + Intergenic
986848857 5:11786536-11786558 CAGGAAAGGCTGAAGCAAGATGG + Intronic
986914049 5:12594714-12594736 CTGACAAGGCAGAAGGTGAAGGG + Intergenic
987743023 5:21934772-21934794 GAGAAAAGGAAGAATGTGGAGGG - Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988331192 5:29842028-29842050 ACAAAAAGGCAGAAGTAGGAAGG + Intergenic
988692900 5:33590527-33590549 CTCATAAGGCTGAAGGAGGAAGG - Intronic
988970312 5:36460288-36460310 TAGACAAGGCAAAAGGGGGAAGG + Intergenic
989249551 5:39294048-39294070 CAGAAAAGGCAGTAGTAAGAGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990378782 5:55201002-55201024 CACAAAAGGCAGAAAAAGAACGG + Intergenic
990802440 5:59620045-59620067 CTGAAAAGGCAGAAGCAGGTGGG + Intronic
990804813 5:59647615-59647637 CAGATAAGACTGAAGAAGGATGG + Intronic
990889855 5:60635985-60636007 CAGAAAAGGCTACAGGAGCAGGG - Intronic
991092918 5:62710140-62710162 AAGAAAAGAAAGAGGGAGGAAGG - Intergenic
991549889 5:67824439-67824461 GAGAAAAGGCGGGAGGAGCAAGG - Intergenic
991629221 5:68637891-68637913 CACAAAGGGCAGAGGTAGGATGG + Intergenic
992081895 5:73241372-73241394 CTGAAAAGGTGGTAGGAGGAAGG + Intergenic
992259450 5:74955040-74955062 CAGAAAAGGCAGAGATAGCAGGG - Intergenic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
992942423 5:81775220-81775242 CAGAGAAGGTAGAACCAGGAGGG + Intergenic
993100855 5:83538170-83538192 AAGAAAAGGAAGGAGGAGGAGGG + Exonic
993403341 5:87480287-87480309 AAGAAAAGTCAGAAATAGGAAGG - Intergenic
993436777 5:87905516-87905538 CAGAATAGGCATAAGGATTAAGG - Intergenic
993691578 5:91007436-91007458 CACAAGAGGCAGTAGCAGGATGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
994942302 5:106340331-106340353 GAGAAACGGCAGAGGCAGGAAGG + Intergenic
995015111 5:107301195-107301217 CAAAAAAGACAGAAGTTGGAGGG + Intergenic
995104267 5:108355785-108355807 CACAAAAGGCAGAAAAAGTATGG + Intronic
995308728 5:110687094-110687116 AAGAAAGGTCAGAAGGAGAATGG - Intronic
995337332 5:111014774-111014796 TAGAAAAGGAAGAAGGATAATGG - Intergenic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
995497035 5:112757435-112757457 CAAAAAAGGCAAAAGGAGGCTGG + Intronic
996019916 5:118579627-118579649 GAGACAAGGAAGAAGGGGGAAGG - Intergenic
996075242 5:119185212-119185234 GGGAAAGGGCAGAAGGAGAAGGG - Intronic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996349371 5:122521590-122521612 TATAGAAGGCAGAAGAAGGAAGG - Intergenic
996438731 5:123465086-123465108 CAAAAAAGATAGAAGGAGGATGG + Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996538596 5:124605433-124605455 CACAATAGTCAGAAGGAGCAGGG - Intergenic
996750051 5:126879229-126879251 CAGAAAAGGGTGAAGGTGCATGG - Intronic
996847908 5:127921038-127921060 AAGGAAAGGAGGAAGGAGGAAGG + Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997622289 5:135306749-135306771 CAGAAAAGGCAGGGAGGGGATGG - Intronic
997925509 5:138027336-138027358 CAGAAAAGCCAGCAGGAAGCTGG + Intronic
998232660 5:140371243-140371265 CAGAAAAGAAAAAAGGAGTAGGG - Intronic
998243169 5:140469134-140469156 TAAAAAAGGAAGAAGAAGGAAGG - Intronic
998278484 5:140782042-140782064 CAGAAAAGACAGGAAGATGAGGG + Intergenic
998604066 5:143615599-143615621 GAAAGAAGGAAGAAGGAGGAAGG - Intergenic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
999674780 5:153987986-153988008 AAGAAAAGGAAGGAGGAGGCAGG - Intergenic
999749928 5:154620255-154620277 AAAACAAGACAGAAGGAGGAAGG - Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
999936722 5:156494721-156494743 CAGAAAAGTGGGAAGGAAGAAGG - Intronic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1001275380 5:170346999-170347021 CAGAAAAGGCAGAGTTGGGAAGG + Intergenic
1001514324 5:172344906-172344928 GGGAAAAGGAAGGAGGAGGATGG + Intronic
1001829578 5:174774218-174774240 CAGAGAAGGTGGAAGCAGGAAGG - Intergenic
1001837587 5:174845038-174845060 CAGAGAAGGCAGGAGGCTGACGG - Intergenic
1002103163 5:176867315-176867337 CAGATATGGCAGAAGGTGGGGGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002213993 5:177616260-177616282 CAGAAAAGACAGAAAAAGAAGGG - Intergenic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002400554 5:178989409-178989431 CAGACAGGGAAGAAGGGGGAGGG + Intronic
1002547932 5:179963943-179963965 CAGAAATGACAGAATGAAGAAGG - Intronic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003454480 6:6269027-6269049 AAGTAAAGGCAGAAGGAAGAAGG + Intronic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003670642 6:8154650-8154672 CAGAAGAGGCAGAGAGTGGAAGG + Intergenic
1003841673 6:10126952-10126974 CAGTAAGGGTAGAAGAAGGAGGG - Intronic
1004082068 6:12404522-12404544 CAGACAAGACAGAAGGAGAGAGG - Intergenic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004410176 6:15374201-15374223 CAGAAGAGGCAGCATGCGGAAGG + Exonic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1004546555 6:16603715-16603737 CAGAACAGGCAGGAGGAAGTAGG + Intronic
1004973590 6:20939253-20939275 TAGTAAATGCAGCAGGAGGAAGG - Intronic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005125480 6:22442220-22442242 GAAAAAAAGCAGAAGCAGGAAGG + Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005427994 6:25723951-25723973 CAGAAATGACAGAATAAGGAAGG + Intergenic
1005589753 6:27311651-27311673 CAGAAAAGGGAAAGGGAGGTTGG - Exonic
1005739179 6:28774844-28774866 CAGAAAAGGCAGGACTGGGATGG + Intergenic
1005943381 6:30578096-30578118 CCGAAAAGGCAGGCGGAAGAAGG + Exonic
1006044216 6:31280710-31280732 AAGAAATGGCAGGATGAGGATGG + Intronic
1006094680 6:31648623-31648645 GAGAAAAGGGAGAGGGAGGGTGG + Intronic
1006183765 6:32169025-32169047 CAGACAAGACAGTAGGAGGTGGG + Exonic
1006185026 6:32176641-32176663 CAGAGAAGGCAGGTGGAGGGGGG - Exonic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006387484 6:33739410-33739432 GGGAAGGGGCAGAAGGAGGAGGG + Intronic
1006511466 6:34523785-34523807 TGGAAAAGGCAGAGGCAGGATGG + Intronic
1006518467 6:34557427-34557449 CAGAGAAGGTTGAGGGAGGATGG + Intergenic
1006789698 6:36691838-36691860 CAGAAATGGCAGAAGCAGGATGG - Intergenic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007461422 6:42021932-42021954 CATAAAGGGCTGAAGGAGGCTGG + Intronic
1007702813 6:43774354-43774376 CACCCATGGCAGAAGGAGGAGGG + Exonic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008055389 6:46940450-46940472 TAGATAAGGCAGGAGGAGGCTGG - Intronic
1008246135 6:49175926-49175948 GAGAAAGGGGAGTAGGAGGAAGG + Intergenic
1008384547 6:50873621-50873643 CAGAAAAGGCAAGAGAAAGACGG + Intergenic
1008427937 6:51380915-51380937 CAAAAAAGGAAGAAGAAGAAGGG - Intergenic
1008453291 6:51678406-51678428 CATAAAAGGCAAAAGGAGACTGG - Intronic
1008543392 6:52564973-52564995 CAGAGAAGCATGAAGGAGGAGGG + Intronic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1009052431 6:58292514-58292536 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1009238679 6:61158100-61158122 CAGTCATGGCAGAAGGTGGAGGG - Intergenic
1009450686 6:63796873-63796895 CAGGAAAGGAAGAAGGGAGAAGG - Intronic
1009705222 6:67240675-67240697 CAGAAAAGTTCAAAGGAGGAGGG + Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010029360 6:71257184-71257206 CAGAAAAGGCACAAAAAGGAAGG + Intergenic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1010588387 6:77682836-77682858 CAGAAAAGGCATTCAGAGGAAGG + Intergenic
1010952213 6:82050155-82050177 GAGAAAGAGCAGAAGTAGGAAGG - Intergenic
1011222802 6:85074476-85074498 CAGAAAAGGAAAAGTGAGGATGG + Intergenic
1011334927 6:86249971-86249993 CAGTTATGGCAGAAGGTGGAGGG - Intergenic
1011427990 6:87251426-87251448 CAGAAAAGGCAATGGGAAGAGGG + Intronic
1011888357 6:92126116-92126138 CAGCAAATGCACAAGGAGAAGGG - Intergenic
1012053624 6:94375653-94375675 CAAAAAAGGTTGAAGGAGGGTGG + Intergenic
1012542063 6:100372664-100372686 CAGGAAAGCCACACGGAGGATGG + Intergenic
1012980975 6:105830806-105830828 CAGAAGGGGCAGCTGGAGGAGGG + Intergenic
1013036548 6:106390391-106390413 AAGAAAAGGGAGAGAGAGGAGGG - Intergenic
1013080601 6:106808659-106808681 CAGAAAAGATAGAAGGGGAAAGG - Intergenic
1013280736 6:108634564-108634586 AAGCCAAGGCAGAAGGGGGAAGG - Intronic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013618629 6:111868083-111868105 CAGAGAAGGCTGGAAGAGGAGGG - Intronic
1013751133 6:113407733-113407755 CGGAAAAGTCAGAAGGAGTAAGG - Intergenic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1014262722 6:119238003-119238025 AAGAAAAGGCAGAAAGAGCAGGG - Intronic
1014715558 6:124861048-124861070 CTGAGAAGGGACAAGGAGGAAGG - Intergenic
1015285499 6:131482148-131482170 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1015308795 6:131741696-131741718 GGAAAAAGGCAGAAAGAGGAAGG + Intronic
1015382295 6:132583339-132583361 CAGAATAGGCAGAGGCAGCATGG + Intergenic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1016229553 6:141786077-141786099 AAGAGAAGGAAGAAAGAGGAAGG - Intergenic
1016472920 6:144393701-144393723 TAGAACAGGCAGAAGGAGGTGGG + Intronic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1017658583 6:156652636-156652658 CAGAACAGGCAGAAGAACCAGGG - Intergenic
1017681199 6:156865814-156865836 AAGAAAAGGAAAAAGGAGGAAGG - Intronic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018240914 6:161773821-161773843 CAGAAAAAGAAGAAGAAGAAGGG + Intronic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018276332 6:162135711-162135733 CAGAGAAGGTAGAAGGTGAAAGG + Intronic
1018410543 6:163541932-163541954 CATAAAATGCAAAAAGAGGAAGG - Intronic
1018547353 6:164952345-164952367 CAGAAGTGGCAGAAGGTGGAAGG - Intergenic
1018613978 6:165668734-165668756 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1018640935 6:165903510-165903532 CAGAAAAGACAATTGGAGGAAGG + Intronic
1018650192 6:165986577-165986599 AGGAAAAGGAGGAAGGAGGAAGG - Intronic
1018694095 6:166377042-166377064 CATAAAAGGCAGAAAAAGAATGG - Intronic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1018816810 6:167338999-167339021 TAGAAAAGGAGGAAGGAGGGAGG - Intronic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019012544 6:168853505-168853527 GAAAAATGGCAGAAGGAAGATGG + Intergenic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019278826 7:190272-190294 CAGTAAAGGCACCAGGCGGAAGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019327620 7:446062-446084 AAGGAAAGGAAGAAGGAGGGAGG + Intergenic
1019484100 7:1280601-1280623 GGGAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484153 7:1280881-1280903 GGGAGAAGGAAGAAGGAGGAAGG + Intergenic
1019484182 7:1281034-1281056 GGGAGAAGGAAGAAGGAGGAAGG + Intergenic
1019574658 7:1731345-1731367 CAGAAAAGGGAGAATGATGAAGG + Intronic
1019937738 7:4267331-4267353 GAGAAAAGGAAGAAGGAATAGGG - Exonic
1020430599 7:8113020-8113042 CAGATAAGGCAGCAGCAGGAAGG - Intergenic
1020600063 7:10263371-10263393 CAGATATCGCAGAAGGAGGTGGG - Intergenic
1021212683 7:17874559-17874581 AAGAAAAGGCAAAAGAAGAAAGG + Intronic
1021287075 7:18793551-18793573 AAGGAAGGGCAGAAGGAAGAGGG + Intronic
1021396769 7:20159005-20159027 AAGTAAAGACAGAAGGAGAAAGG - Exonic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1022096161 7:27142878-27142900 AAGAAGAGGAGGAAGGAGGAAGG + Intronic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022359515 7:29644671-29644693 CAGAAAAGGCAGGACTGGGATGG + Intergenic
1022636596 7:32142172-32142194 AAGAAAAGGCAGAAGGAGAAGGG + Intronic
1022670299 7:32449357-32449379 AAGAAGAGGAAGAAGGAGAAGGG + Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023155133 7:37242957-37242979 CAAAACAGGCAGAAGGTAGAGGG - Intronic
1023549701 7:41356746-41356768 CAGAAAAGGGAACAGCAGGATGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023763435 7:43488309-43488331 CAAAAAAGAAAGAAAGAGGAAGG + Intronic
1023998517 7:45176647-45176669 GAGCAAAGGCATGAGGAGGAAGG + Intronic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024252399 7:47516476-47516498 TAGACAAGGCAGAGGCAGGATGG - Intronic
1024513995 7:50228079-50228101 CAGAAAGGACAAAATGAGGAAGG - Intergenic
1024682009 7:51700382-51700404 CAGAAAAGACAGAAAAAGAATGG + Intergenic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025481396 7:60988144-60988166 AAGAAAAGAAAAAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025830600 7:65045888-65045910 AAGGAAAGGAAGAAGGAGGGTGG - Intergenic
1025917755 7:65879674-65879696 AAGGAAAGGAAGAAGGAGGGTGG - Intronic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026231178 7:68485392-68485414 AAGAAAGGGAAGAGGGAGGAAGG + Intergenic
1026336551 7:69398748-69398770 GAGAAAAGGGAGAATAAGGAAGG + Intergenic
1026403909 7:70044418-70044440 CAAAAAAGGCAGAGGGTGGGGGG - Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027230580 7:76269434-76269456 CAGAAAAGTGAGATGGGGGATGG + Intronic
1027417942 7:77992131-77992153 GAGAAAAGGCAAAAGGAGATGGG + Intergenic
1027520775 7:79203985-79204007 AAGAAAAGGCACATGGAAGAGGG + Intronic
1027977118 7:85172981-85173003 TAGAAAAGGCATAAGGAACAAGG + Intronic
1028279837 7:88909427-88909449 CTGAAAAGGCAGAAGATGGCAGG + Intronic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028710563 7:93903054-93903076 AATAAAAGGCAGGAGGAGGGTGG - Intronic
1028926916 7:96368188-96368210 CATAAAAGGCAGAAGAAGAGTGG - Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029366948 7:100122712-100122734 CTGAAATGGCAGAAAGGGGAAGG + Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029436752 7:100568042-100568064 CAGGAAAGGCAGGAAGAGCAGGG - Exonic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1029806387 7:103001620-103001642 CAAAGCAGGCAGAAGGAGGTGGG + Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1030473567 7:109999206-109999228 AAGAAATGGCAGAATGAGGATGG - Intergenic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031633648 7:124075196-124075218 AAGCAAAGGGAGAAGGAGAAGGG - Intergenic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032066338 7:128774359-128774381 CAGCAAAGGAAGTAGGAGGAGGG - Intronic
1032238182 7:130141883-130141905 CGGAAAAGCCACAGGGAGGAAGG + Intergenic
1032419142 7:131764126-131764148 GGGAACAGGCAGAAGTAGGAGGG - Intergenic
1032518327 7:132523464-132523486 AGGAAAAGGCAGAAGGCCGACGG + Intronic
1032616816 7:133481830-133481852 CAGAAAGGAGTGAAGGAGGAGGG + Intronic
1032669396 7:134069408-134069430 GAGAAGAGGAGGAAGGAGGAAGG - Intergenic
1032784627 7:135191127-135191149 CAGCAAAGGCAGCCAGAGGATGG + Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033437609 7:141347713-141347735 CAGAGAAGGCAGACGGGGGGTGG - Intronic
1033478691 7:141716460-141716482 AAGAGAGGGCAGAAGGAGAAGGG - Intronic
1033498876 7:141927428-141927450 CAATAAAGGGAGAAGGATGAAGG + Exonic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034133516 7:148742897-148742919 CAGAAAAGGTAGAAAGAGTTGGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034700933 7:153095128-153095150 CAGTCACGGCAGAAGGAGAAAGG + Intergenic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035143323 7:156786226-156786248 AAGAGAAGGAGGAAGGAGGAAGG + Intronic
1035274586 7:157740103-157740125 GATAAAAGGCATATGGAGGAAGG - Intronic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1036916644 8:12810722-12810744 GAGCAAAGGGAGAAGAAGGAAGG - Intergenic
1037123852 8:15321096-15321118 AAGAAAAGGCATAAGGAAGTGGG - Intergenic
1037282133 8:17253318-17253340 AAGAAAAGGCAGAGGGAAAAAGG - Intronic
1037315314 8:17594888-17594910 CACAACAGCCAGAAGGTGGAAGG - Intronic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038528645 8:28298276-28298298 CAGATAAGGCAGTAAGAGGCTGG - Intergenic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038898296 8:31812580-31812602 TAAAAAAGGAAGGAGGAGGAAGG - Intronic
1039053552 8:33515621-33515643 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1039407573 8:37326410-37326432 GAGAAAAGGAACAAGGAGAAAGG - Intergenic
1039579076 8:38649375-38649397 GAGAAAGGGCAGAATAAGGAAGG - Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039805617 8:40994977-40994999 AAAAAAAGACAGAGGGAGGAAGG + Intergenic
1040109312 8:43559625-43559647 CAGAAAAGGCAGGACTGGGACGG + Intergenic
1040800891 8:51338564-51338586 CAGAAAACACTGTAGGAGGATGG - Intronic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041528041 8:58830653-58830675 CAGAAAAGAAGGAAGGAAGAAGG - Intronic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1041978542 8:63828285-63828307 CAGAAAAGGGAGATGAAGAAGGG + Intergenic
1042055399 8:64759050-64759072 GAGAAAAGGAAGGAGGAAGAAGG + Intronic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042576039 8:70219667-70219689 CAGGAAGGGCAGGAGGAGGGTGG + Intronic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1043765753 8:84130063-84130085 CAAAAGAGGCAGGAAGAGGAGGG - Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044737821 8:95297235-95297257 CAACCATGGCAGAAGGAGGAAGG + Intergenic
1044857623 8:96493134-96493156 CAAAAAAGGGACATGGAGGAAGG - Intergenic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1045106986 8:98902122-98902144 GAGAAATGGCAGACGAAGGAGGG - Intronic
1045553095 8:103190142-103190164 CAGAAATGGCAGAGTCAGGAAGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046647906 8:116805775-116805797 TAGAAAAGGCAGGTGGAAGAAGG - Intronic
1046885059 8:119357348-119357370 AAGAAAAGACAGATGGAAGAAGG - Intergenic
1047556971 8:125942120-125942142 CAGAAAAACCAGAAACAGGAAGG - Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1047961285 8:130013871-130013893 CAGAATGGGCAGAAGAATGATGG - Intronic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048928570 8:139292403-139292425 CAGAAATGGATGAAGGAAGAAGG - Intergenic
1048971735 8:139648862-139648884 CAGGAAAGGCAGTGGGGGGATGG - Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049303281 8:141883159-141883181 AAGAGAAGGAAGAAGCAGGAGGG + Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049797700 8:144504109-144504131 CAGAAAGGGCTGAAGGAGCTGGG - Exonic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050565728 9:6880779-6880801 AAAAAAAGGAGGAAGGAGGAAGG - Intronic
1050585277 9:7104341-7104363 CAGTAAAGGAAGAGGTAGGATGG + Intergenic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051058927 9:13023386-13023408 CATAAAAGGCAAAAGAAGGGAGG + Intergenic
1051063124 9:13068692-13068714 CAGAAACAGCAGAAGGATCATGG + Intergenic
1051144921 9:14016729-14016751 CAGAAAGGGCAGGAGCTGGAAGG + Intergenic
1051147337 9:14041441-14041463 AAGAAATGGCAGGATGAGGATGG - Intergenic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1051481365 9:17564788-17564810 CTGAAAAGGAACAAGGGGGAAGG + Intergenic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1051606575 9:18923041-18923063 AAAAAAAGGCAGAAAAAGGAGGG + Intergenic
1052109454 9:24562897-24562919 CAGAAAAGGCAGAGGAGGAAAGG + Intergenic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052982915 9:34461893-34461915 CAGAAAAAGATAAAGGAGGATGG + Intronic
1052997163 9:34557249-34557271 CAGAACATGCAGCAGGGGGAAGG - Intronic
1053073821 9:35116226-35116248 GAGAAGGGGCGGAAGGAGGAGGG - Intronic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054766826 9:69049027-69049049 CAGAACTGCCAGAAGGAGTAAGG - Intronic
1054913049 9:70471615-70471637 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055142344 9:72889847-72889869 CAGAAAAGTAAGAAGGAAGGTGG - Intergenic
1055514798 9:77023630-77023652 GAGAAAAGAAAGAAGGCGGAGGG + Intergenic
1056331467 9:85524490-85524512 CAGAAAAGGCAGAAGAGAGGTGG - Intergenic
1056363448 9:85881244-85881266 CAGTAAAGGCAGATAGAGGTGGG - Intergenic
1056598207 9:88025257-88025279 AAGCAAGGGCAGTAGGAGGAGGG + Intergenic
1056954533 9:91071761-91071783 CAGAAAAGGCAGAGGGATGTGGG + Intergenic
1057357859 9:94346536-94346558 AAGTAAAGTCAGAAGTAGGACGG + Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057649890 9:96911073-96911095 AAGTAAAGTCAGAAGTAGGACGG - Intronic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057884779 9:98822070-98822092 CAAACTAGGCAGGAGGAGGAGGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058145408 9:101405653-101405675 CAGAAAAGGCCAAAGAAGTAGGG + Intronic
1058217085 9:102248178-102248200 CACAAAATGGAGAATGAGGAAGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058672742 9:107374265-107374287 CAGAAACGGCAGTAGAGGGAAGG + Intergenic
1058782704 9:108354244-108354266 CAGTCATGGCAGAAGGAGAAGGG - Intergenic
1059081830 9:111258082-111258104 CAGTTAAGGCAGGAGGTGGAAGG + Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059398628 9:114054720-114054742 CTGAAAAGGCAAAACCAGGAGGG - Exonic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1060172294 9:121471788-121471810 CAGAAAAGGCAGATGGCTGCAGG + Intergenic
1060199160 9:121641818-121641840 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1060493543 9:124101795-124101817 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1060716118 9:125930796-125930818 CAGACAAGGGATATGGAGGATGG - Intronic
1060871001 9:127040102-127040124 AAGAAAAGGCTGAAGTAGGCCGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1061928229 9:133818066-133818088 CAAAAAAGGCAGAGGGCGGCCGG + Intronic
1062098044 9:134712685-134712707 CAGAAAAGCCAGGGGCAGGATGG - Intronic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062607740 9:137355586-137355608 GAGAAAGGGCGGAAGGAGAAAGG + Intronic
1062607769 9:137355687-137355709 GAGAAAGGGAGGAAGGAGGAAGG + Intronic
1062683582 9:137798441-137798463 CAGCAAAGGAAGCAAGAGGAGGG + Intronic
1185592522 X:1286968-1286990 GAGAAAGGATAGAAGGAGGAGGG + Intronic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185787482 X:2903110-2903132 GAGAAAAAGAAGAAGGAGAAGGG - Intergenic
1185826769 X:3258779-3258801 CAGAAATGGGAGAGGCAGGAAGG - Intergenic
1186058716 X:5680404-5680426 CAGAAAGAGAAGAAGGATGACGG - Intergenic
1186086463 X:5995839-5995861 CAGAAAAGAAAGAGTGAGGATGG - Intronic
1186494634 X:10002423-10002445 AAGAAAAGAGAGAGGGAGGAAGG + Intergenic
1186554862 X:10547274-10547296 CAAAAAAGAAAGAAGGAGGCCGG + Intronic
1187195536 X:17080204-17080226 GAGAAAAGGCAGAGAGAAGAAGG - Intronic
1187263676 X:17710782-17710804 CAGTAAAGGCAGAATGTGCATGG + Intronic
1187377914 X:18773686-18773708 CAGAAATGTCAGAAGTGGGAAGG - Intronic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187750874 X:22463641-22463663 CAGAAAAGGCAGAGAGAGAGAGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189197098 X:39162060-39162082 GAGAAAGGGGAGGAGGAGGAAGG - Intergenic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189532760 X:41903274-41903296 GGGAGACGGCAGAAGGAGGAAGG + Intronic
1189698492 X:43691765-43691787 CAGACAAGGCAGTAGAAGAAAGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189738365 X:44094297-44094319 AAGAAAAGAAAAAAGGAGGAAGG - Intergenic
1189756628 X:44278530-44278552 AGAAAAAGGCAGAAGCAGGAAGG + Intronic
1189848392 X:45156937-45156959 AAGAAAAGGAAGAGGAAGGAAGG - Intronic
1189921248 X:45905040-45905062 AATAAATGGCTGAAGGAGGAAGG - Intergenic
1190123401 X:47682646-47682668 AAGGAAAGAAAGAAGGAGGAAGG - Intergenic
1190311857 X:49122564-49122586 AAGAAGAGGAAGAAGGTGGAAGG - Intronic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1190973136 X:55371985-55372007 CTTATATGGCAGAAGGAGGAAGG + Intergenic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1192533639 X:71910788-71910810 GAGAAAAGAGAGGAGGAGGAGGG + Intergenic
1193103008 X:77636935-77636957 AGGAGAAGGAAGAAGGAGGAAGG + Intronic
1193563574 X:83049991-83050013 TAGAAAAGGCAGGTGGAAGAAGG - Intergenic
1193886466 X:86988049-86988071 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1194790738 X:98146271-98146293 AAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195343272 X:103925453-103925475 CAAAAATGGCAGAAGGAGTTGGG + Intronic
1195363722 X:104108014-104108036 CAAAAATGGCAGAAGGAGTTGGG - Intronic
1195512394 X:105732187-105732209 CAGAGAAGGCAGAAAAAGCATGG - Intronic
1195804086 X:108743143-108743165 AGGAAAGGGCAGAAGGAAGAAGG + Intergenic
1195924592 X:110012891-110012913 AGGAAATGGCAGAGGGAGGAAGG + Intronic
1196731084 X:118942217-118942239 AAAAAAGGGAAGAAGGAGGAAGG + Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197091094 X:122538657-122538679 AAGAAACGGCAGAAAGAGGATGG + Intergenic
1197514982 X:127415883-127415905 CAGAAAAGGAATAATGAGAAAGG - Intergenic
1197748951 X:129952140-129952162 CAGAAAAGGCTGACAGTGGAAGG - Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1197816326 X:130502347-130502369 GAAAAAAGTGAGAAGGAGGAGGG - Intergenic
1198400112 X:136260654-136260676 CAGAAAAGGCTGATGTAAGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198683682 X:139205965-139205987 AAGAAAAGAGAGAAGGAGGGAGG + Intronic
1198714322 X:139540231-139540253 GAGAAAAGTCAGAATGAGAAGGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199137546 X:144270889-144270911 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199489208 X:148380158-148380180 CTGAAAAGGAAGAAGGTGAAGGG + Intergenic
1199768261 X:150956404-150956426 CAGAGAAGGCAGAGTGAAGAGGG - Intergenic
1199795308 X:151190284-151190306 CAGAAAAGGCAGAAAAAGAGTGG + Intergenic
1200128357 X:153828793-153828815 CCGAAAAGGAAGCAGGAGGATGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200957968 Y:8970565-8970587 CACAAATGGCAGAGGGAGGAGGG - Intergenic
1200978207 Y:9236328-9236350 GAGAGAAGGAAGAGGGAGGAAGG - Intergenic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic
1201437900 Y:13979192-13979214 CAAATCAGGCAGAAGGAGGTGGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201696006 Y:16827057-16827079 CAGAAATGGGAGGAAGAGGAAGG - Intergenic
1202081923 Y:21092498-21092520 CAGAAAAGCCTAAAGAAGGAAGG - Intergenic
1202270966 Y:23073652-23073674 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202295060 Y:23347030-23347052 CAGAAAGGGAAGAAGGGGGATGG - Intergenic
1202423961 Y:24707396-24707418 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202446828 Y:24962689-24962711 CAGAAAGGGAAGAAGGGGGATGG - Intergenic