ID: 1189705611

View in Genome Browser
Species Human (GRCh38)
Location X:43756119-43756141
Sequence GCAAAAAGTCATATTCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189705611_1189705612 -5 Left 1189705611 X:43756119-43756141 CCTGGTTGAATATGACTTTTTGC No data
Right 1189705612 X:43756137-43756159 TTTGCACGCCTGCTGAATACTGG No data
1189705611_1189705615 13 Left 1189705611 X:43756119-43756141 CCTGGTTGAATATGACTTTTTGC No data
Right 1189705615 X:43756155-43756177 ACTGGGCCCTTGAATCCACCTGG No data
1189705611_1189705613 -4 Left 1189705611 X:43756119-43756141 CCTGGTTGAATATGACTTTTTGC No data
Right 1189705613 X:43756138-43756160 TTGCACGCCTGCTGAATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189705611 Original CRISPR GCAAAAAGTCATATTCAACC AGG (reversed) Intergenic
No off target data available for this crispr