ID: 1189705612

View in Genome Browser
Species Human (GRCh38)
Location X:43756137-43756159
Sequence TTTGCACGCCTGCTGAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189705611_1189705612 -5 Left 1189705611 X:43756119-43756141 CCTGGTTGAATATGACTTTTTGC No data
Right 1189705612 X:43756137-43756159 TTTGCACGCCTGCTGAATACTGG No data
1189705607_1189705612 20 Left 1189705607 X:43756094-43756116 CCCAGGTGCTGCTGATGTCTTGC No data
Right 1189705612 X:43756137-43756159 TTTGCACGCCTGCTGAATACTGG No data
1189705608_1189705612 19 Left 1189705608 X:43756095-43756117 CCAGGTGCTGCTGATGTCTTGCT No data
Right 1189705612 X:43756137-43756159 TTTGCACGCCTGCTGAATACTGG No data
1189705610_1189705612 -4 Left 1189705610 X:43756118-43756140 CCCTGGTTGAATATGACTTTTTG No data
Right 1189705612 X:43756137-43756159 TTTGCACGCCTGCTGAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189705612 Original CRISPR TTTGCACGCCTGCTGAATAC TGG Intergenic
No off target data available for this crispr