ID: 1189705613

View in Genome Browser
Species Human (GRCh38)
Location X:43756138-43756160
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189705610_1189705613 -3 Left 1189705610 X:43756118-43756140 CCCTGGTTGAATATGACTTTTTG No data
Right 1189705613 X:43756138-43756160 TTGCACGCCTGCTGAATACTGGG No data
1189705608_1189705613 20 Left 1189705608 X:43756095-43756117 CCAGGTGCTGCTGATGTCTTGCT No data
Right 1189705613 X:43756138-43756160 TTGCACGCCTGCTGAATACTGGG No data
1189705607_1189705613 21 Left 1189705607 X:43756094-43756116 CCCAGGTGCTGCTGATGTCTTGC No data
Right 1189705613 X:43756138-43756160 TTGCACGCCTGCTGAATACTGGG No data
1189705611_1189705613 -4 Left 1189705611 X:43756119-43756141 CCTGGTTGAATATGACTTTTTGC No data
Right 1189705613 X:43756138-43756160 TTGCACGCCTGCTGAATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189705613 Original CRISPR TTGCACGCCTGCTGAATACT GGG Intergenic
No off target data available for this crispr