ID: 1189707234

View in Genome Browser
Species Human (GRCh38)
Location X:43770995-43771017
Sequence GTGTTGACTAAGATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189707234_1189707240 19 Left 1189707234 X:43770995-43771017 CCATGTTCCATCTTAGTCAACAC 0: 1
1: 1
2: 1
3: 8
4: 140
Right 1189707240 X:43771037-43771059 TATTAGAAAACCAAATGAGCTGG 0: 1
1: 0
2: 3
3: 31
4: 387
1189707234_1189707237 -9 Left 1189707234 X:43770995-43771017 CCATGTTCCATCTTAGTCAACAC 0: 1
1: 1
2: 1
3: 8
4: 140
Right 1189707237 X:43771009-43771031 AGTCAACACTGTACACCACTGGG 0: 1
1: 0
2: 1
3: 7
4: 91
1189707234_1189707236 -10 Left 1189707234 X:43770995-43771017 CCATGTTCCATCTTAGTCAACAC 0: 1
1: 1
2: 1
3: 8
4: 140
Right 1189707236 X:43771008-43771030 TAGTCAACACTGTACACCACTGG 0: 1
1: 0
2: 2
3: 24
4: 196
1189707234_1189707242 29 Left 1189707234 X:43770995-43771017 CCATGTTCCATCTTAGTCAACAC 0: 1
1: 1
2: 1
3: 8
4: 140
Right 1189707242 X:43771047-43771069 CCAAATGAGCTGGCTTGCATTGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189707234 Original CRISPR GTGTTGACTAAGATGGAACA TGG (reversed) Intronic
900730815 1:4258396-4258418 GTGCTGACTAAAAGGGACCAAGG + Intergenic
904254165 1:29244019-29244041 GTGATGACTCAGAAGGGACAAGG + Intronic
906196965 1:43935645-43935667 GTGTTGATAGAGATGGAACTTGG + Exonic
906539208 1:46572149-46572171 ATGTGGGCTAAGATGGAACCTGG + Exonic
908296311 1:62717064-62717086 GTGTTGAATAAGATAGATAAAGG - Intergenic
911138094 1:94464689-94464711 ATGTTGACTTAGATGAAACATGG + Intronic
912511847 1:110195105-110195127 GGAGTGACAAAGATGGAACAGGG - Intronic
913325717 1:117626715-117626737 GTGTTGAGTAACATGAAACTTGG + Exonic
913474209 1:119221272-119221294 GTGTTGACTATAAGGGAGCATGG - Intergenic
915716218 1:157947564-157947586 GTTTTGACAGAGAAGGAACAAGG + Intergenic
917956923 1:180108957-180108979 GAGTTGACAAATATGTAACAGGG - Intronic
918727749 1:187947543-187947565 GTGGTGACTAAAATGGGCCAAGG + Intergenic
919090606 1:192974659-192974681 GAGTTGAGAAAGATGGAAGAAGG + Intergenic
921027212 1:211296599-211296621 CTGATGACTAAGATGGCATATGG - Intronic
921162677 1:212484207-212484229 CTGTTTACAAAGATGGGACAGGG - Intergenic
921285934 1:213609436-213609458 GTGTGGACAAAGCTGGTACATGG - Intergenic
921784335 1:219210338-219210360 GTGGTGACATAGAGGGAACAGGG + Intronic
924421719 1:243916363-243916385 GTGTTGAATATGTTGGAGCAGGG - Intergenic
1065987490 10:30969723-30969745 ATGTTTAATAGGATGGAACATGG - Intronic
1067945748 10:50687011-50687033 GTGTTGGCCAGGAGGGAACAAGG - Intergenic
1068470797 10:57460393-57460415 GTGTTGAACAAGATGCATCAAGG - Intergenic
1073755710 10:106578682-106578704 GTATTGACTAGAATGAAACATGG - Intronic
1076644229 10:131941363-131941385 GTCTTAAATTAGATGGAACATGG + Intronic
1080079716 11:28201825-28201847 AATTTGACAAAGATGGAACAAGG + Intronic
1090770952 11:129919517-129919539 TTGTTCACTATGATGGAGCATGG + Intronic
1097772825 12:63608766-63608788 GTGATAGCTGAGATGGAACAGGG - Intronic
1099604174 12:84780730-84780752 TTGCTGTCTCAGATGGAACATGG + Intergenic
1100414774 12:94360232-94360254 GTGTTGAATAAGATTGACAAGGG - Intronic
1100442415 12:94629056-94629078 GATTTGACTCAGATGGAAGAAGG - Intronic
1103976093 12:124703712-124703734 TTGATGATTAAGATGGAAAAAGG + Intergenic
1104351757 12:128050088-128050110 GTGTTGAAGAAGAGGAAACATGG - Intergenic
1105492154 13:20899309-20899331 ATGTTGACTAAGAACCAACATGG + Intronic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1107526164 13:41233835-41233857 ATGCTGAGTAAGATGGAAAAAGG + Intronic
1107632047 13:42352099-42352121 GTGGTGACAAAGAAGGCACAGGG + Intergenic
1107653715 13:42571023-42571045 ATGGTGATCAAGATGGAACATGG - Intronic
1109343656 13:61091049-61091071 GTATTGTCTAAGTTGGCACAAGG - Intergenic
1109606546 13:64705124-64705146 GTGAATACGAAGATGGAACAAGG - Intergenic
1111392829 13:87621050-87621072 GAGGTGATTAAGATGGAAAAAGG - Intergenic
1117940505 14:60959218-60959240 GTGTTCACTGAGGTGGACCACGG - Intronic
1118590404 14:67396670-67396692 ATGTGGGCAAAGATGGAACAAGG - Intronic
1118763492 14:68894923-68894945 GGAATGACTAAGATGGAAGACGG + Intronic
1120640287 14:87002578-87002600 ATGTTTACTAAGATGGAACGTGG - Intergenic
1124182553 15:27490466-27490488 GTGTTGACTAAGATGGAAAATGG - Intronic
1125974328 15:43937749-43937771 GTGTTGACTTGGTTGGACCATGG + Intronic
1126615133 15:50570482-50570504 TTGCTAACTAAGATGAAACAAGG - Intronic
1136671648 16:31863963-31863985 TTGTGGACTCTGATGGAACATGG + Intergenic
1137911043 16:52378902-52378924 GTGATGACTCAGCTGGGACAGGG - Intergenic
1138564489 16:57823027-57823049 GTTTAGACTATGATGGAAGAGGG + Intronic
1140231328 16:73119592-73119614 CTGTTGGCTCACATGGAACATGG - Intergenic
1141867241 16:86758969-86758991 GTGTTGAATCAGATGAAACTAGG + Intergenic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147909177 17:43844582-43844604 GTGTGGCCTAAGGTGGAACTAGG + Intergenic
1151050715 17:70975790-70975812 TTATTGATAAAGATGGAACATGG + Intergenic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1155005015 18:21720991-21721013 GTGTGGATTGAGATGAAACAAGG + Intronic
1155117200 18:22781124-22781146 GTGTTGATTAAGCTGTAACCTGG - Intergenic
1157690713 18:49679644-49679666 GTGTTGACTTGGATGGGCCACGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1166709956 19:44930521-44930543 CTGTTGCCTAGGCTGGAACACGG + Intergenic
925675662 2:6358582-6358604 GTGTTGACAAGGAAGGAACTGGG - Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926622685 2:15061245-15061267 GTGTTGACTGAGATGCAGCCTGG + Intergenic
928143321 2:28749902-28749924 GTTTTGGCTAAGCTGGAACTAGG - Intergenic
930865913 2:56121702-56121724 CTGTTGTCAAGGATGGAACAAGG + Intergenic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
932548117 2:72736773-72736795 GTGCTGACTATCATGGACCAGGG + Intronic
934772343 2:96915024-96915046 GTGTTTGCTGAGATGGAAAATGG + Intronic
938641650 2:133287236-133287258 CTGGTGACTAAAATGGTACAAGG - Intronic
939092622 2:137797132-137797154 GTTTTTACTAAGATGGTCCAAGG - Intergenic
940039295 2:149343228-149343250 GTACTGAATAAGATCGAACATGG + Intronic
940967055 2:159850361-159850383 GTGTTGAGCCAGATTGAACAAGG - Exonic
941354225 2:164468833-164468855 GTGTCAACTAAGATGGCAGAGGG + Intergenic
944560945 2:200937164-200937186 GTGGTGATTAAGAAGGAAGAGGG + Intronic
944840581 2:203620156-203620178 GTGTTGAGTAATATGCAACATGG - Intergenic
944921006 2:204413054-204413076 GTTGTGACTAAAATGGATCAAGG + Intergenic
946213452 2:218165455-218165477 GTGTGGGGTAAGATGGAATATGG + Intronic
947150656 2:227111838-227111860 GTGTTGACTAAAATTGAGGAAGG + Intronic
1173917922 20:46723363-46723385 GTGGCTACTAAGATGGAAGAGGG - Intronic
1175201827 20:57283370-57283392 TTGTTGTCTGAGATGGAAAAGGG + Intergenic
1177841162 21:26235476-26235498 GTCTTGACTAAGAAGGAAAGAGG - Intergenic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1180065664 21:45410997-45411019 CTGTTGTCTAAGTTGAAACATGG - Intronic
1182161474 22:28126546-28126568 ATGTTGATTTAGATGGAAAAAGG + Intronic
1182325551 22:29509939-29509961 GTGTAGACTGACAGGGAACAAGG + Intronic
950223256 3:11212778-11212800 GTTTTGACTTTGATGAAACAGGG - Intronic
952433158 3:33245908-33245930 GAGTTGAATAAGATTGAACATGG + Intergenic
953432855 3:42854071-42854093 TTGATGTCTAAGATGGAAGAGGG + Intronic
954396459 3:50295872-50295894 GTATTGACAAAGACGGAACATGG - Intronic
959104979 3:102055231-102055253 CTGTTGACTAAGAATAAACAGGG + Intergenic
959552271 3:107675405-107675427 TTGTTTACTAAGAGGGCACAAGG - Intronic
960206822 3:114912027-114912049 ATGTTCACTTATATGGAACAAGG - Intronic
961146816 3:124600927-124600949 GCTATGACTAAGAAGGAACATGG + Intronic
961768691 3:129232140-129232162 GTTTGGACTAAGGTGGAGCAGGG - Intergenic
963169800 3:142239519-142239541 GTGTTGCCTTACATGGAAGAAGG + Intergenic
963800883 3:149675051-149675073 GTTTGGACTAAGATGGTAGAAGG + Intronic
964344223 3:155739760-155739782 TTCTTGCCTAAGATGTAACATGG - Intronic
969282906 4:6183176-6183198 CTGATGTCTAAAATGGAACAGGG + Intronic
976262696 4:83160639-83160661 GTGTAGAATAATTTGGAACAAGG + Intergenic
982509100 4:156258274-156258296 GCATTGACTAAGATGAAACTGGG + Intergenic
983793964 4:171836767-171836789 GTGATGGCTATGATGGAAGATGG + Intronic
986242311 5:5972038-5972060 GTGTTGACTTGGCTGGACCATGG - Intergenic
989899176 5:47142385-47142407 TTGTGGTCTAAGATGGAAAAGGG + Intergenic
989899616 5:47150393-47150415 TTGTGGTCTAAGATGGAAAAGGG + Intergenic
992118946 5:73571082-73571104 GGGTTAAATAAGATGGCACAGGG - Intronic
992118952 5:73571116-73571138 GGGTTAAATAAGATGGCACAGGG - Intronic
992118958 5:73571165-73571187 GGGTTAAATAAGATGGCACAGGG - Intronic
995370424 5:111412354-111412376 GTTTTGACTAAAATGAGACATGG - Intronic
996103764 5:119473758-119473780 GTGTTTAGTAAGATGGGATAGGG + Intronic
996307116 5:122059998-122060020 ATGTTGAATAAGAAGGAACTTGG + Intronic
996876127 5:128242436-128242458 CTGTTGACTAAGCTGGAATTCGG - Intergenic
999965125 5:156801127-156801149 GTCTTCACAAATATGGAACAAGG - Intergenic
1001392967 5:171395141-171395163 CTGTTGCCCAGGATGGAACACGG - Intronic
1004584331 6:16984961-16984983 GTATTGAATAAGAAGGACCATGG + Intergenic
1006768628 6:36531894-36531916 GTGTTCTTTATGATGGAACAGGG + Intronic
1010223351 6:73466815-73466837 TTCTACACTAAGATGGAACATGG - Intronic
1013663405 6:112322176-112322198 GTGTTGGAAAATATGGAACAGGG + Intergenic
1016827131 6:148398915-148398937 ATGCTGACTAAATTGGAACAGGG - Intronic
1020913089 7:14158237-14158259 GTGTTGTCTCAGATAGAAGAGGG - Intronic
1022365409 7:29709901-29709923 GTGATAGCTGAGATGGAACAGGG + Intergenic
1022932389 7:35132460-35132482 GTGATAGCTGAGATGGAACAGGG - Intergenic
1029828315 7:103225255-103225277 GTGATAGCTGAGATGGAACAGGG - Intergenic
1031790452 7:126095083-126095105 TTATGGACTAAGATGGAAAATGG - Intergenic
1031849754 7:126849808-126849830 GGGTTGGCTAAGTTGGAGCATGG - Intronic
1033046099 7:137963270-137963292 GTGCTGACTAAGTGGGAACAGGG - Intronic
1033670842 7:143491258-143491280 CTGGAGACTAAGCTGGAACAAGG + Intergenic
1036045851 8:5139591-5139613 GTGTTGACACAAATGGAAGATGG - Intergenic
1036295472 8:7531804-7531826 CTGATGACAAAGATAGAACAAGG - Intergenic
1036327097 8:7789215-7789237 CTGATGACAAAGATAGAACAAGG + Intergenic
1037254929 8:16942439-16942461 GTGTTGAGTAACCTGGAACTGGG - Intergenic
1040654528 8:49490712-49490734 GTGTTCACTAAAATGGGGCAGGG + Intergenic
1041581662 8:59467046-59467068 TTGTTGATTAAGATGTATCATGG + Intergenic
1043367711 8:79554622-79554644 GTCTTGCCTGACATGGAACATGG - Intergenic
1046889167 8:119402108-119402130 GTGATGACAATGATGGAACATGG - Intergenic
1047706800 8:127507160-127507182 CTGTTGCCTAAGCTGGAGCATGG - Intergenic
1052242685 9:26293319-26293341 GTGTGCACTAAGAGGTAACAAGG - Intergenic
1058843789 9:108935386-108935408 GTGTAAAGTAAGATGGAGCAAGG + Intronic
1060367843 9:123037112-123037134 GTGTTCAGTGAGATGGAAGATGG + Intronic
1062132199 9:134903772-134903794 GTGTTGAAGAAAATGGAAGATGG + Intergenic
1203407580 Un_KI270538v1:57613-57635 GTGTTGCCTATGGTGGAAAAAGG - Intergenic
1203407827 Un_KI270538v1:62414-62436 GTGTTGCCTATGGTGGAAAAAGG - Intergenic
1186235246 X:7500998-7501020 ATGATGGCAAAGATGGAACAAGG + Intergenic
1188557078 X:31424541-31424563 GTGCTTACAAAGATGGAAGATGG + Intronic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1189753064 X:44242670-44242692 GTGTTGACTGAGATAGGAGAGGG - Intronic
1189780407 X:44508445-44508467 GTGTTCACTAAGAGGCAAAATGG - Intergenic
1192302440 X:69919206-69919228 GTGATGACTAAGGGGGAAGAGGG + Intronic
1193695585 X:84703752-84703774 GAGTTGAGTAAGTTGGAGCATGG + Intergenic
1197598496 X:128496533-128496555 GGGTTGACTAGGAAGGGACATGG - Intergenic
1198398431 X:136246540-136246562 GTGTTTACTATGATGGGCCAGGG + Intronic