ID: 1189709704

View in Genome Browser
Species Human (GRCh38)
Location X:43796555-43796577
Sequence AAGGAGGAGGAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10167
Summary {0: 3, 1: 64, 2: 391, 3: 2053, 4: 7656}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189709694_1189709704 28 Left 1189709694 X:43796504-43796526 CCTCAATTTTCAGTTAAGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG 0: 3
1: 64
2: 391
3: 2053
4: 7656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189709704 Original CRISPR AAGGAGGAGGAGAAAGAGGA GGG Intronic
Too many off-targets to display for this crispr