ID: 1189710471

View in Genome Browser
Species Human (GRCh38)
Location X:43806353-43806375
Sequence AAGAATACGGGTCAGTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189710468_1189710471 -10 Left 1189710468 X:43806340-43806362 CCTTCAAAGTTTGAAGAATACGG 0: 1
1: 0
2: 0
3: 12
4: 87
Right 1189710471 X:43806353-43806375 AAGAATACGGGTCAGTTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1189710467_1189710471 5 Left 1189710467 X:43806325-43806347 CCTTATTTTTCATAACCTTCAAA 0: 1
1: 1
2: 11
3: 72
4: 783
Right 1189710471 X:43806353-43806375 AAGAATACGGGTCAGTTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 81
1189710466_1189710471 6 Left 1189710466 X:43806324-43806346 CCCTTATTTTTCATAACCTTCAA 0: 1
1: 1
2: 5
3: 42
4: 600
Right 1189710471 X:43806353-43806375 AAGAATACGGGTCAGTTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189710471 Original CRISPR AAGAATACGGGTCAGTTATC TGG Intronic
904885111 1:33731602-33731624 CAGAAGTCGGGTCATTTATCTGG - Intronic
910605965 1:89084845-89084867 AAGAAAGAGGGTAAGTTATCCGG + Intergenic
911294527 1:96098541-96098563 AAGAATAAGGATCAGTTATTTGG + Intergenic
911756745 1:101566836-101566858 AAGAATACATGACACTTATCTGG + Intergenic
912100933 1:106203423-106203445 AAGAATACGTGTCAATTTTACGG - Intergenic
913475471 1:119232897-119232919 AAGAATTTGGGGCAGTTACCAGG - Intergenic
915138346 1:153749909-153749931 TAGAAAACAGGGCAGTTATCTGG - Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
920682352 1:208082844-208082866 AAGAATACGGGTGGGTTAAAAGG - Intronic
920788502 1:209065536-209065558 AGGAATATGGCTCAGTTGTCAGG - Intergenic
923690139 1:236184661-236184683 AAAAAAACAGGTCAGTCATCTGG - Intronic
923963012 1:239105113-239105135 AAGTATACGCGTCAGGTATGAGG - Intergenic
1068846650 10:61683604-61683626 AATAATAAAGGTCAGTTATGAGG + Intronic
1069105779 10:64381765-64381787 AAGAATACATGCCAGTTGTCAGG - Intergenic
1078689232 11:13562327-13562349 ATGAATAAGGGAGAGTTATCTGG + Intergenic
1078834366 11:15012927-15012949 AAGAATAAGCTTCAGTTTTCAGG + Intronic
1084904578 11:72335787-72335809 GAGAATACGGTTCAATCATCTGG - Intronic
1093765926 12:22962585-22962607 AAAAATACGGGTGATTTATAAGG - Intergenic
1095238809 12:39832692-39832714 AAGTAGAGGGGTCAGTTAACTGG - Intronic
1098811762 12:75103430-75103452 AAGAATAAGAATCAATTATCAGG - Intronic
1100837668 12:98582300-98582322 AAGAGTACGGGACATTTATTTGG - Intergenic
1100999010 12:100336442-100336464 CAGAGTACTGGTCAGTTATTTGG + Intronic
1109591852 13:64494694-64494716 AAGAAAACAGGTCACTGATCGGG + Intergenic
1115577863 14:34728605-34728627 AAGAATACGGTTTAGTGATATGG - Intergenic
1120481247 14:85052736-85052758 AAGAATATAAGCCAGTTATCTGG + Intergenic
1123082409 14:105701819-105701841 AGGAATAGGGGTTAGTGATCAGG + Intergenic
1124553420 15:30704617-30704639 AAGAGAACTGGTCAGTTATTTGG + Intronic
1124677825 15:31701051-31701073 AAGAGAACTGGTCAGTTATTTGG - Intronic
1127858772 15:62975239-62975261 AAGCATAGGCCTCAGTTATCAGG + Intergenic
1128836385 15:70812367-70812389 AAGAATAAGGGTCTGCTAGCCGG + Intergenic
1130262370 15:82366207-82366229 AAGAATATGGATCATTTATTTGG + Intergenic
1130278858 15:82502800-82502822 AAGAATATGGATCATTTATTTGG - Intergenic
1131407012 15:92173385-92173407 AAGAAAAGTGGTCAGTTATGGGG - Intergenic
1139199893 16:64963973-64963995 AAGAACATGGGTCAGAAATCTGG + Intronic
1141864977 16:86743991-86744013 AAGTATACGTGTCAGGTATGAGG + Intergenic
1203059027 16_KI270728v1_random:952574-952596 GAAAATACGGGACAGTTATTGGG + Intergenic
1145784482 17:27585239-27585261 AAGAAAAGGGGTCAGTCAGCTGG - Intronic
1148441566 17:47714239-47714261 AAGAATAGAGGTCAGATATAAGG + Intergenic
1152272152 17:79331000-79331022 AAGCATACCGGTCAGTTAGCGGG - Intronic
1154235266 18:12599624-12599646 AAGAATACAGGTCAGGTACATGG + Intronic
1155633097 18:27918829-27918851 AAGAGTACTGGTCAGTTATTCGG - Intergenic
1163887369 19:19978508-19978530 AAGAAGGCGGGTCACTTATGGGG + Intergenic
1165984387 19:39755045-39755067 AAACATAATGGTCAGTTATCAGG + Intergenic
926407989 2:12573504-12573526 AAGTATACGTGTCAGGTATGAGG - Intergenic
929505023 2:42521723-42521745 AAGATTCAGGGGCAGTTATCTGG - Intronic
936897421 2:117444370-117444392 TAGAATAATGTTCAGTTATCTGG + Intergenic
937205462 2:120233833-120233855 AATAATACGGATCAGTCAACTGG - Intergenic
946541439 2:220688496-220688518 AAGAAGACTGCTCAGTTTTCAGG - Intergenic
1169896284 20:10508418-10508440 AGGAATAAGCCTCAGTTATCTGG - Intronic
1177228683 21:18290533-18290555 TTGAATACAGGTCAGTTATTAGG - Intronic
1182804218 22:33057214-33057236 AAGAATTCTGATCAGTGATCAGG - Intronic
1183902283 22:41015454-41015476 AAGAATACTGGTCAGGTATTTGG + Intergenic
949855539 3:8457845-8457867 ATGAATAAGGGTCATTTGTCTGG + Intergenic
953618758 3:44514412-44514434 AAGGATATGGGTCAGTGATGAGG + Intergenic
961150923 3:124637146-124637168 AAGAATAAGGAACAGTGATCAGG - Intronic
965136596 3:164780030-164780052 AAGAATGCATGTCAGTTTTCTGG - Intergenic
974759928 4:66261801-66261823 AGGAATACTGGTAAGATATCTGG + Intergenic
980262576 4:130471369-130471391 AAGCCTACTGATCAGTTATCTGG - Intergenic
980312707 4:131154302-131154324 AAGGATACGGGTGAGGTATAGGG + Intergenic
982813368 4:159854800-159854822 GAGAATACGGATCAGTGAACAGG + Intergenic
983596840 4:169478236-169478258 AAGAAAACCGTTCAGTTATATGG + Intronic
993427973 5:87794242-87794264 AAGCATACAGGGCAGTTACCTGG + Intergenic
993752476 5:91688077-91688099 AAGAATAAGAGTCAGTTGTAGGG - Intergenic
1004290138 6:14359204-14359226 AAAAATAAGGATCACTTATCTGG + Intergenic
1004696997 6:18043112-18043134 AAGAAAAGGGGTCACTTAGCAGG - Intergenic
1009760295 6:67996457-67996479 AAGAATAGGGGTCAAAAATCTGG - Intergenic
1010095496 6:72038625-72038647 AAGAATCAAGGTCAGTTATGCGG + Intronic
1010767398 6:79791917-79791939 AAGATTACAGGTCAGTTATTTGG + Intergenic
1011980902 6:93376478-93376500 AAGAATTCATGTCAGTTATTTGG - Intronic
1013864663 6:114680534-114680556 AAAAATACAGATCAGTCATCTGG - Intergenic
1015287829 6:131506304-131506326 AAGTATATGGGTCAGGTATGAGG + Intergenic
1032687256 7:134247891-134247913 AAGAAGACGGGTGATTAATCTGG + Intronic
1040918589 8:52590146-52590168 AGGAATACTGGTGAGTTTTCTGG - Intergenic
1042090033 8:65148893-65148915 ATGAATTCTGGTCAGTTTTCTGG - Intergenic
1043149153 8:76691802-76691824 GAACATACGGATCAGTTATCAGG - Intronic
1044190747 8:89314318-89314340 AGGAATATGGGGCAGTTCTCTGG - Intergenic
1044392579 8:91669285-91669307 AAGAATATGGGTCTTTTCTCAGG + Intergenic
1047829324 8:128613877-128613899 AAGTATATGGGTCAGCTATGAGG + Intergenic
1052192052 9:25672665-25672687 AAGTATACGTGTCAGGTATGAGG - Intergenic
1053610031 9:39703573-39703595 ATGAATACAGGTCACTTATTGGG + Intergenic
1053868097 9:42461799-42461821 ATGAATACAGGTCACTTATTGGG + Intergenic
1054088221 9:60767573-60767595 ATGAATACAGGTCACTTATTGGG - Intergenic
1054243493 9:62638822-62638844 ATGAATACAGGTCACTTATTGGG - Intergenic
1054557617 9:66673344-66673366 ATGAATACAGGTCACTTATTGGG - Intergenic
1057235068 9:93351359-93351381 AAGTATACGTGTCAGGTATGAGG - Intergenic
1189710471 X:43806353-43806375 AAGAATACGGGTCAGTTATCTGG + Intronic
1194308318 X:92275030-92275052 AAGTATATGCGTCAGTTATGAGG + Intronic