ID: 1189711163

View in Genome Browser
Species Human (GRCh38)
Location X:43813760-43813782
Sequence GGCACTGTTCTGGGCACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1056
Summary {0: 1, 1: 12, 2: 38, 3: 194, 4: 811}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189711157_1189711163 -9 Left 1189711157 X:43813746-43813768 CCTCCTGTCTGCCTGGCACTGTT 0: 1
1: 0
2: 16
3: 175
4: 1158
Right 1189711163 X:43813760-43813782 GGCACTGTTCTGGGCACTGGAGG 0: 1
1: 12
2: 38
3: 194
4: 811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189711163 Original CRISPR GGCACTGTTCTGGGCACTGG AGG Intronic
900315696 1:2055226-2055248 GGCACTGTGCTTGGCAATGGTGG + Intronic
900393929 1:2445403-2445425 GGCAGTGGTCGGGGAACTGGTGG + Intronic
900565108 1:3328296-3328318 GGAGCTGTTCTGTGCAGTGGGGG + Intronic
900570930 1:3357847-3357869 GGACCTGTCCTGGGCACTGCAGG - Intronic
900593024 1:3468213-3468235 GGCACTGGTTTGGGGAATGGGGG + Intronic
901102177 1:6727426-6727448 GGCGCTGATCTGGGCACTGGAGG - Intergenic
901117177 1:6856511-6856533 GGCACTATTCTAGTCACTGGGGG + Intronic
901137637 1:7008104-7008126 AGCACTGTCCTGGGCACCGTGGG + Intronic
901208042 1:7508570-7508592 GGCACAGTGCTGGGTGCTGGGGG - Intronic
901402663 1:9025306-9025328 GGCCCTGTACTAGGCCCTGGAGG + Intronic
901681954 1:10918278-10918300 GTCACAGTTAAGGGCACTGGGGG - Intergenic
901802523 1:11716865-11716887 GACATTGCTCTGGACACTGGGGG + Intronic
901933249 1:12610479-12610501 GGCACTGTTCTGGGCACTGAAGG - Intronic
902080047 1:13814568-13814590 GGGCCTGTCCTGGGCACTGTAGG + Intronic
902222153 1:14973263-14973285 GACATTATTCTGGGCACTTGGGG + Intronic
902263473 1:15244669-15244691 GACATTGTTCTAGGGACTGGTGG + Intergenic
902308894 1:15565246-15565268 GGCCCTGTGCTGGGCACCAGAGG - Intronic
902373709 1:16020272-16020294 GGCACTGTTCTAGGCTCTGAAGG + Intronic
902509242 1:16956878-16956900 GGCACTGGCCTGGACACTGTGGG + Intronic
902518765 1:17004267-17004289 GGCACTGGTTTGGGCACAGACGG - Intronic
902534393 1:17111007-17111029 GGCACAGTTCTAGGCATTGAGGG + Intronic
902776015 1:18675517-18675539 GGTGCTGTCCTGGGCTCTGGAGG + Intronic
902889388 1:19430919-19430941 GGCACTGTGCTTGGCTCTGCTGG + Intronic
902931555 1:19735040-19735062 GGCACTGTGCTGGGCACTAGGGG + Intronic
902958228 1:19941606-19941628 GGCATCATTCTAGGCACTGGCGG - Intergenic
902992742 1:20200714-20200736 GGCACTGTTTTAGGCACTGGGGG - Intergenic
903037703 1:20504713-20504735 GGCACAGTTCTCCGCACTAGGGG - Intronic
903188618 1:21643619-21643641 GGCACTGTCGTGGCCACAGGGGG - Intronic
903277547 1:22231545-22231567 GGCACAGTTCGAGGCCCTGGAGG + Intergenic
903354457 1:22737727-22737749 GACTCTGTGCTAGGCACTGGAGG - Intronic
903818116 1:26079957-26079979 GGCACTGCTCTTGGCCCTGGGGG + Intergenic
904346801 1:29878024-29878046 GGCACTGTGCTTGGCACTGTGGG + Intergenic
904448546 1:30596004-30596026 GACACTGTGCTTGGCACTGTGGG - Intergenic
904501531 1:30915521-30915543 GGCACAGATCTGGACACTGAGGG + Intergenic
904608191 1:31710222-31710244 GGGGCTGTCCTGGGCACTGTAGG - Intergenic
904700267 1:32353745-32353767 GGGCCTGTACTGGGCTCTGGGGG - Intronic
905193718 1:36257352-36257374 GGCACTATTCTAAACACTGGAGG - Intronic
905266019 1:36754988-36755010 GGCGCTGTCCTGGGCCCAGGGGG + Intergenic
905528843 1:38660580-38660602 GGCACTATTCCGGGCACTGTGGG + Intergenic
905819511 1:40979136-40979158 CGCACTGTGCTGGGCACCGAGGG - Intergenic
905890771 1:41517015-41517037 GGCTCTGTTCTGGGTGCTGGGGG - Intronic
905942041 1:41871320-41871342 GTCATTGTGCTGGGCACTGTGGG - Intronic
905949798 1:41940495-41940517 GGCACTGTGCTAGGCACTGTTGG + Intronic
906514675 1:46431890-46431912 GGCCCTGGGCTGGCCACTGGGGG + Intergenic
906680376 1:47722206-47722228 GGCACTGTGCTGAGCACTGTGGG - Intergenic
906952818 1:50348556-50348578 GGCTCTGTGTTAGGCACTGGGGG + Intergenic
907053195 1:51343662-51343684 AGCACTGTACTAGGCACTGCAGG - Intronic
907274722 1:53310839-53310861 GGCCCTGTGATGGGCACTGGGGG + Intronic
907310894 1:53538504-53538526 GGCACAGACCTCGGCACTGGAGG - Intronic
907552156 1:55313581-55313603 GGCTCTGTACTGGGCGATGGAGG + Intergenic
907593430 1:55697743-55697765 GCCACTTTAGTGGGCACTGGTGG + Intergenic
907697402 1:56746202-56746224 AGCACTGTTCTAGGAAATGGGGG - Intronic
907734790 1:57101708-57101730 GGCACTCTGCTAGGCACTGGGGG + Intronic
907744752 1:57201803-57201825 GGCTCTGTGCTAGGCTCTGGAGG - Intronic
907919931 1:58903018-58903040 GGCACTGTGCTGGACACTGGTGG - Intergenic
908304772 1:62801433-62801455 GGCACTGTTCTAGGCACTGCAGG - Intronic
908767981 1:67571321-67571343 GGAACTGTGCTTGGCTCTGGAGG + Intergenic
908779768 1:67679632-67679654 GGCACTGTTCTAGTCACTTAGGG + Intergenic
908805669 1:67928907-67928929 GACACTGTTTTAGGCATTGGAGG + Intergenic
909061632 1:70885656-70885678 GGCACTGTGCTAGGCTCTGAGGG + Intronic
909323412 1:74318791-74318813 ACCACTGTGCTAGGCACTGGGGG - Intronic
910214941 1:84833792-84833814 AGCACTGTTCTGGACACTTTAGG - Intronic
910227854 1:84954770-84954792 GGCACTGTGCTAGGCACTGAAGG + Intronic
910643097 1:89485697-89485719 GACACTGTGCTAGGCACAGGAGG + Intergenic
910970226 1:92848743-92848765 GGCACTGTTTGAGGCACTGAGGG - Intronic
911043011 1:93606955-93606977 GGCAATGTGCAGGTCACTGGTGG + Intronic
911180351 1:94854860-94854882 GGGGCTGTCCTGCGCACTGGAGG - Intronic
911564558 1:99448225-99448247 GGCACTGTGCCAGGCACTAGGGG - Intergenic
911881112 1:103239130-103239152 GGGCCTGTCCTGGGCACTGCAGG - Intergenic
911889301 1:103346542-103346564 GGCACAGTTCTTGACACTTGGGG + Intergenic
912137233 1:106676379-106676401 GGCATTGTTCTTGGTACTGGGGG - Intergenic
912436675 1:109667006-109667028 GGCACTGTCCTGAGCATTGCAGG + Intronic
912498723 1:110107738-110107760 GGCACAGTTCTAGGCACAGTGGG + Intergenic
912514585 1:110210124-110210146 CGCGCTGGGCTGGGCACTGGCGG + Intergenic
912800481 1:112716751-112716773 GGAACTTTTCTGGGCTCTGTCGG + Intergenic
912936014 1:114004200-114004222 GGCATTGTTCTAGGCAGTGCAGG + Intergenic
912970214 1:114274546-114274568 GGTACTGTGGTGGGCACTGGGGG + Intergenic
913153428 1:116068612-116068634 GCCAATGTTCTGGGCACAGCAGG - Exonic
913311709 1:117503715-117503737 GGCACTGTTCAAGCCACTTGAGG + Intronic
914690415 1:150020928-150020950 GGCCCTGTTCTGGTCTCTGCTGG + Intergenic
914953499 1:152140580-152140602 GACACTGTGCTGGGCACTAGGGG - Intergenic
915008638 1:152664192-152664214 GGCACTGTGGTGGGCATTTGGGG - Exonic
915009924 1:152676102-152676124 GGCACTGTGGTGGGCATTTGGGG - Exonic
915915817 1:159940218-159940240 AGTGCTGTTCAGGGCACTGGGGG + Intronic
916459231 1:165005585-165005607 GGCACTGTTCTAGACACTGGAGG - Intergenic
916478272 1:165191044-165191066 GGCACTGTGCTAGGCACTGGGGG + Intergenic
916682177 1:167114698-167114720 CTCACTGTTCTGGGCACTCTAGG + Intronic
916716712 1:167452575-167452597 CGCACTGTGCTGGGCAGTGAGGG + Intronic
916865196 1:168848983-168849005 GGCACTGTGCTGGGCACCATAGG - Intergenic
916952725 1:169797109-169797131 GGCACTGTTCTAGGTGCTGAGGG - Intronic
917076033 1:171206172-171206194 TGCCCTGTGCTGGGAACTGGTGG + Intronic
917587575 1:176443422-176443444 GGCAATGTTCTAGGTACTGGGGG + Intergenic
917772048 1:178290189-178290211 GGAACTGTTCTAAGAACTGGTGG - Intronic
917838441 1:178958924-178958946 AGCACTGTGCTGGGCCCTGAGGG + Intergenic
917904093 1:179572509-179572531 GGCACTATTCTAAGCCCTGGGGG - Intronic
918045218 1:180937199-180937221 GGCACTATACTAGGCACTGTGGG + Intronic
918078359 1:181187704-181187726 AGCACTGTGCTGGGTATTGGGGG - Intergenic
918106474 1:181419632-181419654 GGCACTGTTTTGGACCCTGAAGG - Intronic
918191691 1:182181709-182181731 GGCTCTGGGCTGGGCACTAGGGG - Intergenic
919632401 1:199972034-199972056 GGCACTGTTCCAGGCACTGGGGG + Intergenic
919636318 1:200006828-200006850 TGCACTGTGTAGGGCACTGGAGG - Intergenic
919803966 1:201369724-201369746 GGCCCTGTTCTGGGGGCTGGGGG - Intronic
919958412 1:202441105-202441127 GGCACTGTGCTAGGAACTAGGGG - Intronic
920089235 1:203440646-203440668 GGCACAGTGCTGGGCACGTGGGG + Intergenic
920503960 1:206503500-206503522 AGCACTGTTCTAGGCACTAAAGG - Intergenic
920804841 1:209223207-209223229 TGCACTGTTCTAGGCACTGAGGG + Intergenic
921163058 1:212486537-212486559 GGCTCTGTCCTGGACACTGTGGG + Intergenic
921268042 1:213442311-213442333 GGCACTGTTCTGGGCACAGGGGG - Intergenic
921416188 1:214890193-214890215 GGCACTGTTCTGGGCCCTGGAGG + Intergenic
921812673 1:219532412-219532434 GGCACTGTTCTAGACCCTGTAGG + Intergenic
922348665 1:224718036-224718058 GCCACTGTTCTAGGAATTGGGGG + Intronic
922606061 1:226890655-226890677 GGCACTGTGCTAGGCATTGGGGG + Intronic
922774418 1:228208212-228208234 GGGGCTGTTCTGTGCCCTGGAGG + Intronic
922932765 1:229403213-229403235 AGCACTCTGCTGGCCACTGGGGG - Intergenic
923762581 1:236860191-236860213 GGGGCTGTCCTGGGCACTGCAGG - Intronic
923916263 1:238509551-238509573 GGGCCTCTTCTGGGCACTTGGGG - Intergenic
1063460930 10:6214721-6214743 GGCACTGAGCTGGGCACAGCGGG - Intronic
1063758328 10:9041705-9041727 GGTACTGGCCTAGGCACTGGGGG - Intergenic
1063964895 10:11339300-11339322 GGCACTGTGCGAGGCACGGGGGG - Intergenic
1064210800 10:13359222-13359244 AGCAGTGTGCTAGGCACTGGGGG - Intergenic
1064439798 10:15343429-15343451 AGCACTGTTCTAGGCGCTGAGGG - Intronic
1064440007 10:15345318-15345340 AGCCCTGTTCTAGGCACTGAGGG - Intronic
1064912479 10:20417379-20417401 GGCACTGTGCTAGGAGCTGGAGG + Intergenic
1064940317 10:20726939-20726961 GGCACTGGACTAGGCAGTGGGGG - Intergenic
1065167149 10:22991520-22991542 GGCACTGTGCTAGGCTCTTGGGG + Intronic
1065803048 10:29369991-29370013 GGGAATGATCTGGGCATTGGGGG + Intergenic
1066286073 10:33967184-33967206 GCCACTCTTCTGGGAACTGGGGG - Intergenic
1066336548 10:34483685-34483707 GGCACTGTTTTGGGCACTGAGGG - Intronic
1066648240 10:37632446-37632468 GGCACTGTGCTAAGTACTGGAGG - Intergenic
1066733064 10:38450898-38450920 GGGACTGTTCAGGCTACTGGTGG + Intergenic
1067458231 10:46438975-46438997 GGCTCTGGTCTGGGCCCTGAGGG - Intergenic
1067628965 10:47945659-47945681 GGCTCTGGTCTGGGCCCTGAGGG + Intergenic
1068652641 10:59539447-59539469 AGCACTGTGCTGGGCGCTGGGGG - Intergenic
1068947004 10:62739535-62739557 GGCACTGTATTGGGCATTGTGGG + Intergenic
1069060458 10:63889196-63889218 GGAACTGTGCTGTGCACTGTAGG - Intergenic
1069662608 10:70133335-70133357 GGCACTGTGCTAGGCGTTGGAGG + Intergenic
1070280548 10:75045036-75045058 GGCACTGTGCTGGGTGCTGATGG + Intronic
1070345815 10:75540781-75540803 GGCACTCTTCTGAACACTAGGGG - Intronic
1070604536 10:77889482-77889504 GCCACTGTTCTGGACACTCATGG - Intronic
1070616650 10:77974457-77974479 GGCACTGTTCTAGGTATTAGGGG - Intronic
1070626616 10:78055409-78055431 GGCATTGTTCTGGGCGCCAGGGG - Exonic
1070691719 10:78532019-78532041 GGCACTGTCCTGTGCATTGTAGG - Intergenic
1070828373 10:79404151-79404173 GGCACTTCTCTGGGTCCTGGAGG - Intronic
1071137661 10:82470622-82470644 GGCTGAGTTCTGGGCACTGCTGG - Intronic
1071497022 10:86175627-86175649 GGCACAGCTCTGGGCACTGGAGG - Intronic
1072004183 10:91227119-91227141 GGCACTTTGCTAGCCACTGGGGG + Intronic
1072051972 10:91713936-91713958 GTCATTGTGCTGGGCATTGGAGG + Intergenic
1072506386 10:96071825-96071847 GGCACTGTGGTGGGCACTAGTGG + Intergenic
1072677180 10:97476604-97476626 AGCCCTGTTCTGGGCACTGAGGG - Intronic
1072729819 10:97838162-97838184 GGTACTGTTCTGGGCACTGGCGG - Intergenic
1074224108 10:111466909-111466931 GGCAATGTCCTAGGCACTAGAGG - Intergenic
1074259252 10:111835290-111835312 GGCACTGTTGTAGGAACTTGGGG + Intergenic
1074386128 10:113018038-113018060 GGCACAGTGCTGGGTGCTGGGGG + Intronic
1074860948 10:117510082-117510104 GGCACTGTCTCAGGCACTGGAGG + Intergenic
1074949229 10:118312838-118312860 GGCACTGTTCTAGGTGCTGGAGG + Intronic
1075087605 10:119423945-119423967 GGCACTGTGCTGGGTGCTGGGGG + Intronic
1075352972 10:121742556-121742578 GGCACTGTGCTGGGTACAGGAGG - Exonic
1075540652 10:123311058-123311080 GGGGCTGTTCTGGGCACTCATGG - Intergenic
1075557212 10:123442284-123442306 GGCACTATTCCAGGCTCTGGGGG + Intergenic
1075695701 10:124433615-124433637 GGCACTGTGCTAGGCCCTGGGGG - Intergenic
1075695989 10:124435747-124435769 GGCACTGTGCTAGGCCCTGGGGG - Intergenic
1075736037 10:124665150-124665172 GGAACTGTGCAGAGCACTGGAGG - Intronic
1076425073 10:130361879-130361901 GGCACCGAGCTTGGCACTGGAGG + Intergenic
1076569100 10:131420670-131420692 GGCACTGTTCCTGGCACTGAGGG - Intergenic
1077295380 11:1823967-1823989 GCCACTGTGCTGGCCACTGGTGG + Intergenic
1077751752 11:4978507-4978529 CCCACTGTGCTGGGCACTGTTGG - Intronic
1078099224 11:8319884-8319906 AGCACTGTGCTAGGAACTGGGGG - Intergenic
1078149729 11:8748359-8748381 GGCTCTGTGCTGGGCACTGGAGG - Intronic
1078301905 11:10140072-10140094 AGCACTGTGCCGGGAACTGGTGG - Intronic
1078542173 11:12221536-12221558 AGGACTGTGCAGGGCACTGGAGG - Intronic
1078571391 11:12461082-12461104 GGCACTGTGCTGGGCTCCGAGGG + Intronic
1078714340 11:13825698-13825720 GGCACTGTTCTTGGCAGCAGTGG + Intergenic
1078823924 11:14908003-14908025 GGCCCTGTTCTGGGCGCTTGGGG - Intronic
1079022422 11:16920261-16920283 AGCACTGTGCTAGGCACTGTAGG - Intronic
1079320172 11:19445328-19445350 AGCACTGTGCTGGACACTGTGGG + Intronic
1079398263 11:20084611-20084633 GACACTGGGCTGGGCACTGCAGG - Intronic
1079610711 11:22429523-22429545 GACACTGTGCTGGGCACTGGAGG + Intergenic
1079972549 11:27054148-27054170 GGCACTGCAATAGGCACTGGGGG - Intronic
1080423906 11:32138795-32138817 GCCACTGTTCTGGGCCCTTGGGG - Intergenic
1081627680 11:44665333-44665355 GGGACTGTTCTGGATCCTGGGGG - Intergenic
1081700827 11:45151558-45151580 GGCACTGTGCTGGGCCTAGGGGG + Intronic
1081747716 11:45484625-45484647 GTCACTTTTCTGGCCACTGCTGG + Intergenic
1082677587 11:56126555-56126577 GGTACTGTTCTAGGTACTGGGGG - Intergenic
1082735697 11:56853336-56853358 GGCACTATTCTAGGCACTGAGGG - Intergenic
1082888097 11:58109531-58109553 GTCACTTTTCTGGGGAATGGGGG - Intronic
1083310767 11:61782518-61782540 GGCTCTGTACAGGGGACTGGGGG + Intronic
1084409474 11:68998058-68998080 GGCAATGTTCTAGGCACAGAAGG - Intergenic
1084473083 11:69374577-69374599 TGCCCTGTCCTGGGCACAGGAGG - Intergenic
1084494583 11:69496648-69496670 GGGACTGTCCTGGGCCCTGTAGG - Intergenic
1084520683 11:69660885-69660907 GGCATACTTCTGGGCACTGGTGG - Intronic
1084533890 11:69745731-69745753 GGCACTGGCCTGTGCACTGTGGG + Intergenic
1084957789 11:72700582-72700604 GCCACTGTTCTAGGATCTGGGGG + Intronic
1085042040 11:73332147-73332169 TGCTTTGTTCTGGGCACTGTGGG + Intronic
1085044247 11:73344081-73344103 GGCACTGAGGTGGGCACTGGGGG - Intronic
1085260315 11:75200708-75200730 GGCCCTGTCCTGGCCTCTGGAGG + Intronic
1085286139 11:75362881-75362903 AGCTCTGTTCTAGGCTCTGGGGG - Intergenic
1085360704 11:75882815-75882837 TGCACTGTTCTGGTCACTATAGG - Intronic
1085422932 11:76379816-76379838 GGCATTGTTGTGAGCAGTGGGGG - Intronic
1085649438 11:78254242-78254264 GGGGCTGTTCTAGGCACTAGGGG - Intronic
1086143118 11:83521060-83521082 AGCACTGTTCTAGGGCCTGGGGG - Intronic
1086329472 11:85739141-85739163 GGCACTGTGCAAGGCACTGCAGG - Intronic
1086331712 11:85761061-85761083 GGCACTATTCTAAGCACTGGAGG + Intronic
1086340268 11:85842035-85842057 GGCCCTGTGCTAGGCAATGGTGG + Intergenic
1086404180 11:86486103-86486125 GGCAGAGTACTGGGCACTGATGG - Intronic
1086892259 11:92271600-92271622 AGCACTGTTCTGGGCACTGGAGG - Intergenic
1087044181 11:93830499-93830521 GGCCCTGTCTTGGGCACTGGGGG - Intronic
1087172713 11:95067174-95067196 GGCGCTGCTCTGGGCGCTGACGG - Intergenic
1087792918 11:102426052-102426074 GGCACTGTGCCAGGTACTGGGGG - Intronic
1088741318 11:112769668-112769690 GACACTATGCTGGGCACTGTGGG + Intergenic
1089085872 11:115816236-115816258 TGCACTGACCTGGGGACTGGTGG - Intergenic
1089500437 11:118928798-118928820 GACACCGTCCTGGGCCCTGGAGG + Intronic
1089644936 11:119872743-119872765 GGCACTATGCTGGGTGCTGGGGG - Intergenic
1089817333 11:121188274-121188296 AGGACTGTTCTGTGCACTGTAGG + Intronic
1090859396 11:130639710-130639732 GGGACTGTGCTGCACACTGGTGG + Intergenic
1090957767 11:131528961-131528983 GGCACTGGGCTAGGCACTGTGGG - Intronic
1091033510 11:132212868-132212890 GCCTCTCTTCTAGGCACTGGGGG + Intronic
1091102827 11:132891642-132891664 GGCCATGTTCTAGACACTGGAGG - Intronic
1091159837 11:133410179-133410201 AGCACTGTGCTGGGCGCTGGTGG - Intronic
1091202714 11:133794408-133794430 GGCACTGTCCAGGGTGCTGGGGG - Intergenic
1091728564 12:2863195-2863217 GGGACTGTCCTGTGCACTGAAGG - Intronic
1091822321 12:3484940-3484962 GGCACTGGTATGGGCAGGGGTGG + Intronic
1092754932 12:11754227-11754249 GGCACTCTTCTGTGTCCTGGGGG + Intronic
1093184025 12:15999258-15999280 GACACTATTCTAGGCATTGGAGG + Intronic
1093870748 12:24288232-24288254 GGAGCTGTCCTGGGCACTGTAGG - Intergenic
1093912114 12:24759934-24759956 GGCTCTGTACTAGGCATTGGAGG - Intergenic
1093917471 12:24821683-24821705 GGCTCTGTGCTGAACACTGGAGG + Intronic
1094048046 12:26188732-26188754 TGCACTGTGCTAGGCACTGTAGG + Intronic
1094270180 12:28605444-28605466 GGCCCTCTGCTAGGCACTGGAGG + Intergenic
1094626848 12:32132510-32132532 GGAACTGTGCTGTGCACTGTGGG + Intronic
1095486224 12:42687395-42687417 GGCACTGTGCTAGGCAATGGGGG + Intergenic
1095743812 12:45635302-45635324 GGCACTGTTCTAGGCCTTGTAGG + Intergenic
1096000817 12:48128517-48128539 GGCACTATGCTAGGCACTGGGGG - Intronic
1096564736 12:52469183-52469205 GGCAGTGGTCTTGGCATTGGAGG - Exonic
1096584868 12:52613557-52613579 AGCACTCTCCTGGGCACTGGGGG - Intronic
1096877281 12:54639757-54639779 GGCCATGTTCTGGGGGCTGGTGG + Intergenic
1097628591 12:62031754-62031776 GGCACTGTTCTGGAACATGGAGG - Intronic
1097925543 12:65122144-65122166 GGCACTCTTCCGGGCACTGCCGG - Intergenic
1098066981 12:66628777-66628799 GGAGCTGTTCTGGGCATTGCTGG - Intronic
1098522227 12:71446066-71446088 GGCATTGGTATGGGCACTTGGGG - Intronic
1098812684 12:75115984-75116006 GGCACTGTTCCAGGCACTGCAGG - Intronic
1098988768 12:77041851-77041873 GGCACTGTTCTGGATACTATGGG + Intronic
1099268256 12:80476405-80476427 ATCACTGTTCTAGGCACTTGAGG - Intronic
1099948786 12:89276681-89276703 GGCATTGTTCTGGGAGCTGTGGG + Intergenic
1099966532 12:89452306-89452328 AGCACGTTTCTGGGAACTGGAGG - Intronic
1100274707 12:93061661-93061683 GGCACTGCTCTGAGCTCTGAAGG + Intergenic
1100304558 12:93338482-93338504 GGCAGTGTCGTGGGAACTGGGGG + Intergenic
1100713341 12:97280410-97280432 GGCATTGTTCAGGGCACAGTGGG - Intergenic
1100731086 12:97470365-97470387 GGCACCGTGCTAGGCAGTGGAGG - Intergenic
1100760701 12:97803820-97803842 GGCACTGTTCTGGGGTGTGAAGG - Intergenic
1100784313 12:98063047-98063069 GGCAGTGCTCTGGCTACTGGTGG - Intergenic
1101166889 12:102046730-102046752 GGTACTATTCTGGGCACTAAAGG - Intronic
1101289636 12:103354576-103354598 AACACTGTTCTGGGTACTGGAGG - Intronic
1101373482 12:104151387-104151409 GGCACTGTTCTAGGCACAGGGGG - Intergenic
1101400994 12:104386621-104386643 GGCACTGTTCTGGGCAGCTCTGG + Intergenic
1101404432 12:104415512-104415534 GTCACTGTGCTAGGCGCTGGGGG + Intergenic
1101590897 12:106124439-106124461 AGCACTGTTCTAGGCACTTGGGG + Intronic
1101591107 12:106126278-106126300 AGCACTGTGCTAGGCACTGGGGG - Intronic
1101836798 12:108301530-108301552 GGCACTGAGCTGGGGGCTGGTGG - Intronic
1101931889 12:109021375-109021397 GGCACTGTAATAGGCACTGGGGG + Intergenic
1102008312 12:109602784-109602806 GGCTCTGTACTGGCCAGTGGGGG + Intergenic
1102053212 12:109878361-109878383 AGGACTGTTCTGTGCACTGTAGG + Intronic
1102124065 12:110466290-110466312 GGCACTGTTTTGGGCCCTGGGGG - Intronic
1102469406 12:113151128-113151150 GGCACCCTTGTAGGCACTGGGGG - Intronic
1102470778 12:113158773-113158795 GGCCCTGTGCTGGGCACTGGGGG - Exonic
1102474356 12:113179206-113179228 GGCCCCGGTCTGGGCACTGTGGG + Exonic
1102536561 12:113585817-113585839 GGAACTGTCCTGTGCACTGCAGG - Intergenic
1102707402 12:114894133-114894155 GGCACTGTTCTTGGCACTGGTGG - Intergenic
1102908912 12:116697627-116697649 GGGGCTGTCCTGGGCACTGCAGG - Intergenic
1103010946 12:117457756-117457778 GCGACTGTCCTGGGCATTGGAGG - Exonic
1103142275 12:118559138-118559160 GGCGTTGTGCTAGGCACTGGGGG - Intergenic
1103222390 12:119256709-119256731 GGGACTGTCCTGGACACTGCAGG + Intergenic
1103344698 12:120241529-120241551 GGCACTATGCTGGGCATGGGAGG + Intronic
1103607725 12:122099438-122099460 GGCATCGTGCTGCGCACTGGTGG + Intronic
1104010712 12:124928197-124928219 GGCACTGTTCTAGGTACTGAGGG - Intergenic
1104089859 12:125507285-125507307 GGTACTTTCCTAGGCACTGGGGG + Intronic
1104419170 12:128621097-128621119 GGCTCTGCTCTGGGCCCTGGGGG + Intronic
1104422864 12:128651555-128651577 GTCACTGTTCCAGGCAGTGGGGG + Intronic
1104592712 12:130097608-130097630 GGAACTGTGCTAGGCCCTGGGGG + Intergenic
1104764253 12:131316152-131316174 GGGGCTGTTCCAGGCACTGGGGG + Intergenic
1104948218 12:132426925-132426947 GACACTGCTCTAGGCCCTGGGGG + Intergenic
1105320746 13:19319161-19319183 GGCACTTTTCTAGGCACTGAGGG + Intergenic
1105631923 13:22177853-22177875 GGCAATTTTATGGGCACTGTGGG + Intergenic
1105818240 13:24056588-24056610 GACACTGTGCTGGGCTCTGTGGG - Intronic
1105853442 13:24355533-24355555 GACACTGCTCTGGCTACTGGGGG + Intergenic
1106106104 13:26734759-26734781 GACACTATTCTGGGTACAGGGGG - Intergenic
1106139547 13:27000792-27000814 GGCCCTGTGCTAAGCACTGGGGG + Intergenic
1106420602 13:29582499-29582521 GGCACTGCTCTTGGTACAGGAGG + Intronic
1106536282 13:30646628-30646650 AGCACTGTCCTGTGCACTGTAGG - Intronic
1107644344 13:42478532-42478554 GGCACTGGCCTGGGTCCTGGGGG + Intergenic
1107770235 13:43781342-43781364 GGCACTGTTCTCAGTGCTGGGGG + Intronic
1107809819 13:44189549-44189571 GGCACTATCCTAGGCATTGGGGG - Intergenic
1108008551 13:45978282-45978304 GGCACTTTGCTAGGCACTTGAGG - Intronic
1108300986 13:49075958-49075980 GGGACTGTTCTGTGAACTGTAGG + Intronic
1108303573 13:49106704-49106726 GATAGTGTTCTGGGCACTAGAGG - Intronic
1109201741 13:59439243-59439265 AGCACTGTGCTAGGCAATGGAGG + Intergenic
1110149301 13:72230174-72230196 GTCACTGTTGTGGGCAATTGGGG + Intergenic
1110231593 13:73173067-73173089 GGAACTGTTCTGTGCATTGTAGG + Intergenic
1110424297 13:75348445-75348467 GGCAATGTGCTAGGCACTGGGGG - Intronic
1110558918 13:76888938-76888960 AGCTCTGTTCTAGGCAGTGGGGG - Intergenic
1110647444 13:77904448-77904470 GGCACTGTTCTAGGCAGTTGTGG - Intronic
1110650953 13:77940171-77940193 GGTGCTATTCTAGGCACTGGGGG + Intergenic
1111618702 13:90695731-90695753 GGCATTGTTTTAGGCACTGGAGG + Intergenic
1111660481 13:91203926-91203948 GGATCTGGTCTGGGGACTGGAGG - Intergenic
1111926019 13:94464144-94464166 AGCACTGTTCTGAGCACTGTAGG + Intronic
1112716336 13:102190469-102190491 GGGGCTGTTCTGGGCATTGTAGG - Intronic
1112909917 13:104469086-104469108 CTCACAGTTCTGGACACTGGAGG + Intergenic
1113450031 13:110402561-110402583 TCCACTGTTCTGGGTGCTGGGGG + Intronic
1113560824 13:111279340-111279362 GAGACTGTCCTGGGCACTGTAGG + Intronic
1113697501 13:112356356-112356378 GGCACTGTTCTGGAGACCGCGGG - Intergenic
1114376698 14:22154047-22154069 GGGGCTTTTCTGGGCACTGTAGG + Intergenic
1115010634 14:28540573-28540595 TCCACTGTTCTGGGATCTGGAGG - Intergenic
1115147533 14:30242525-30242547 GGCACTGTTCTAGGCACATCGGG - Intergenic
1115330711 14:32194287-32194309 GGCAATGTTCTAGGCACCAGAGG - Intergenic
1115758914 14:36558223-36558245 GGTACTGGTCTGGGGCCTGGGGG + Intergenic
1116410330 14:44613461-44613483 GGCACTGTGCCAGGCTCTGGGGG - Intergenic
1117316604 14:54577077-54577099 GTCACTGCTGTGGGCAGTGGGGG + Intronic
1117339872 14:54783855-54783877 GGCCCTGCTCTAGGCACAGGGGG + Intronic
1117378126 14:55134293-55134315 GGCGCTGTCCTGTGCACTGCAGG - Intronic
1117720693 14:58626123-58626145 GGCACTGTTATAGGCCCTTGAGG + Intergenic
1117781421 14:59236754-59236776 GGCACTGTTCTAGGTGTTGGAGG - Intronic
1117826307 14:59707517-59707539 GGCTCTTTTCTAGGCACTAGGGG - Intronic
1118111758 14:62729381-62729403 AGCACTGTCCTGGGCAAAGGAGG + Intronic
1118124742 14:62889279-62889301 CACACTGTTCTAGGCACTGAGGG + Intronic
1118348985 14:64960171-64960193 GGCCCTCCTCTGGGCACCGGGGG + Intronic
1118861837 14:69670253-69670275 GGAACTGTGCTCTGCACTGGAGG + Intronic
1119404904 14:74392228-74392250 TGCACTGGCCTGGGCACTGCAGG - Intergenic
1119607404 14:76032623-76032645 GGCACTGTGCAGGAGACTGGGGG - Intronic
1120763704 14:88309083-88309105 GGCACTGTTGTAGGCCCTGGAGG - Intronic
1120908474 14:89642890-89642912 GGCACTGTGCTAGGTACTGGGGG - Intergenic
1120984567 14:90322654-90322676 GGCACAGGTCTAGGTACTGGGGG + Intronic
1120987325 14:90345888-90345910 AGCACTGTCCTGGGCTCTAGGGG + Intergenic
1121303162 14:92888010-92888032 TGCACTGTTCTAGGCACCAGAGG + Intergenic
1121346228 14:93137759-93137781 GGCACTGTTGTTGGCATTGGGGG + Intergenic
1121396794 14:93631829-93631851 GACACTGTGCTTGGCACTGGAGG + Intronic
1121568327 14:94927191-94927213 GGCTCTGAGCTGGGCACTGTAGG - Intergenic
1121618929 14:95332671-95332693 GCCACTGTGCTGGGCACGGATGG + Intergenic
1121623071 14:95363575-95363597 GGGGCTGTCCTGGGCACTGCAGG - Intergenic
1121719025 14:96096426-96096448 GGCACTGTTCTAGACACTCAGGG + Intergenic
1122244276 14:100390726-100390748 GGCACAGATCTGCACACTGGTGG - Intronic
1122783278 14:104152738-104152760 AGCCCTGTGCTGGGCACTGGTGG - Intronic
1124026911 15:25975251-25975273 GCCACTGTGCTGGGCTCAGGGGG + Intergenic
1124356753 15:29001125-29001147 GGCACTGGGCTGGGCACTGGAGG - Intronic
1124563923 15:30798215-30798237 GGCACTGCTGGGGGCTCTGGAGG - Intergenic
1124619828 15:31267309-31267331 GGCAAAGTTCTGGGGACTTGGGG + Intergenic
1125034262 15:35106002-35106024 GGCACTGTGGTGGGAACTGTGGG + Intergenic
1125270543 15:37934216-37934238 GGCTCTGTTCTAAGCACTGGAGG - Intronic
1125356419 15:38821264-38821286 GGCACTGTGCTGGGTGCTGGAGG + Intergenic
1125839688 15:42787992-42788014 GTCACTGTTCTGAATACTGGAGG + Intronic
1126075376 15:44904043-44904065 GGCACTGTGCTGGGTGCTGTGGG + Intergenic
1126082994 15:44983744-44983766 GGCACTGTGCTGGGTGCTGTGGG - Intergenic
1126176781 15:45743275-45743297 GGGGCTGTTCTGGGCACTGCGGG - Intergenic
1126868305 15:52960096-52960118 GGCATTGTTCTAGTCACTGAGGG + Intergenic
1127124656 15:55800408-55800430 GGCCCTGTTCTGTGGAGTGGGGG + Intergenic
1127969284 15:63946083-63946105 GGCCCTGGGCTGGGCAGTGGCGG - Intronic
1128318286 15:66675045-66675067 GGTACTGTTCTGGGATGTGGAGG + Intronic
1128401669 15:67288768-67288790 GGTACTCTTCTAAGCACTGGAGG + Intronic
1128636912 15:69308475-69308497 GGGACTGTCCTGTGCACTGCAGG + Intronic
1128732650 15:70031557-70031579 TGCACTGTGGTTGGCACTGGGGG - Intergenic
1128766610 15:70254923-70254945 GGCTCTTTTCTAGGCACTGCAGG + Intergenic
1128786657 15:70402606-70402628 GCTACTGTGCTGGGCACTGCAGG - Intergenic
1128802017 15:70502861-70502883 GGGACTGGTGTGGGCACAGGTGG - Intergenic
1129169278 15:73798011-73798033 GGCCCCATTCTGGGCCCTGGGGG + Intergenic
1129225691 15:74169151-74169173 GGCCCTTTGCTGGGCACTAGGGG + Intergenic
1129684326 15:77676644-77676666 GGCACTGCACTGGGCAGCGGCGG + Intronic
1129958442 15:79660964-79660986 GGCACTGTGTTGGGCCTTGGAGG + Intergenic
1130065045 15:80596100-80596122 GGAGCTGTGCTGGGCACTGAGGG + Exonic
1130878200 15:88032377-88032399 TGCACACTTCGGGGCACTGGAGG + Intronic
1131018991 15:89082021-89082043 GGGGCTGTCCTGGGCACTGGAGG + Intergenic
1131168945 15:90162886-90162908 GGCACTGCTCTGGGCACTTCTGG - Intronic
1131364779 15:91829127-91829149 GGCACTGTACCGGGCAAAGGAGG + Intergenic
1131393604 15:92069230-92069252 GGGGCTGTTCTGGGCATTGTAGG - Intronic
1131760616 15:95618682-95618704 GGCACTGTGCTAGGCGCTAGGGG + Intergenic
1132201038 15:99955011-99955033 GGCCCTGTGGTGGGCCCTGGAGG + Intergenic
1132945718 16:2530583-2530605 GGTGCTGTCCTGGGCACAGGAGG + Exonic
1133333110 16:4988335-4988357 GACACAGCTCTGGGCACAGGTGG - Intronic
1133357014 16:5143995-5144017 GCGGCTGTTCTGGGCACTGTGGG - Intergenic
1133380574 16:5326926-5326948 GGCACTGTCCTAGGAACTGAGGG + Intergenic
1133647528 16:7777988-7778010 GGCACTATGTTGGACACTGGTGG + Intergenic
1133823404 16:9256800-9256822 GGGGCTGTTCTGCGCACTGTGGG + Intergenic
1133985061 16:10662129-10662151 GGGACTGTCCTGTGCACTGTGGG + Intronic
1134363310 16:13552970-13552992 GGGCCTGTTCTGTGCACTGTGGG + Intergenic
1134673620 16:16074140-16074162 GGGACTGTCCTGTGCACTGTGGG + Intronic
1134770146 16:16801180-16801202 GGGACTATTCTGTGCACTGTAGG - Intergenic
1134795932 16:17036944-17036966 GGGGCTGTTCTGTGCACTGTAGG - Intergenic
1134805430 16:17120133-17120155 GGCACTATGCTAGGCACTGGAGG - Intronic
1134816715 16:17211887-17211909 GGGACTGTCCTGCGCACTGTAGG + Intronic
1135404513 16:22188849-22188871 GGCACTGTGCTGAGCAACGGAGG + Intronic
1135562488 16:23487426-23487448 GGGACTGTCCTGTGCACTGTAGG - Intronic
1135723280 16:24834801-24834823 GGCAGTGTTCTAAGCTCTGGGGG - Intergenic
1135774459 16:25244115-25244137 GGCACTGTTCTGGTGTCCGGAGG + Exonic
1135841941 16:25884913-25884935 GGCACTGTTCTGGACACTAAGGG - Intronic
1135853175 16:25982963-25982985 GGCACTGTTCTGGGCACTGAAGG + Intronic
1136013718 16:27381824-27381846 AGCACTGTCCTAGGCCCTGGGGG + Intergenic
1136093572 16:27937789-27937811 GGGACTGTCCTGGGCCCAGGAGG + Intronic
1136558901 16:31026759-31026781 GGCACTGTTGTAGGTGCTGGGGG + Intergenic
1136924383 16:34358416-34358438 GGCCCTGTGCTGGGCAAAGGTGG + Intergenic
1136980190 16:35053390-35053412 GGCCCTGTGCTGGGCAAAGGTGG - Intergenic
1137661668 16:50212491-50212513 GGCACTGTCCTGGGTGGTGGTGG + Intronic
1137858496 16:51821314-51821336 GGCAGTGTTCTTGGCTCTAGAGG + Intergenic
1137919423 16:52472215-52472237 GGGGCTGTGCTAGGCACTGGAGG + Intronic
1137942187 16:52699149-52699171 GTCATTCTTCTGGCCACTGGAGG - Intergenic
1138217358 16:55215863-55215885 GGTACTGTCCTGGGCACTGTAGG - Intergenic
1138578881 16:57926646-57926668 TGCCCTGTGCTGGGCACAGGAGG - Intronic
1139311220 16:66029885-66029907 GCCACTCTGCTGGGCCCTGGGGG + Intergenic
1139342063 16:66273977-66273999 AGTACTGTGCTAGGCACTGGGGG - Intergenic
1139485037 16:67250745-67250767 GGCACTGTTCTAGGCCCTTTGGG + Intronic
1139738835 16:69017306-69017328 GCCACTGTGCTGGGCCCTGGGGG - Intronic
1139960625 16:70715426-70715448 GGCACTGTGCCAGGCACTGACGG + Intronic
1139967167 16:70752177-70752199 GGCACAGTGCTGGACACTGAAGG - Intronic
1140713347 16:77698488-77698510 GGCACTGTTTTAGCTACTGGGGG + Intergenic
1140733213 16:77874783-77874805 GGCACTGCACTAGGCACTGGAGG - Intronic
1140742648 16:77955350-77955372 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1141020651 16:80493003-80493025 GGTACTGTTCTAGGCTCTAGAGG - Intergenic
1141068203 16:80931030-80931052 GGCACTGTTCTAAGTACTAGGGG + Intergenic
1141148504 16:81548452-81548474 GGCACTGTCCTGGGCATGGTAGG + Intronic
1141400601 16:83743850-83743872 GGCACTCTACTCGGCCCTGGGGG + Intronic
1141465101 16:84200318-84200340 GGCACTGTTCTTGGCTCTCTCGG + Intergenic
1141497012 16:84417199-84417221 GGCACCGTTCTGAGCACTTTTGG - Intronic
1141618636 16:85224587-85224609 GGCACTGTTCTTGGTGATGGTGG + Intergenic
1141648368 16:85379338-85379360 GGCACCATTCTAGGCACTGGGGG - Intergenic
1141765021 16:86052382-86052404 GGCACTGTTCTGGGAGTCGGGGG + Intergenic
1142139285 16:88465559-88465581 GGCACTGTTCTAGGCACCAGGGG - Intronic
1142206923 16:88787709-88787731 GGCAGTGAACTGGGCACAGGTGG - Intergenic
1142380615 16:89729939-89729961 GGGAGTGTTCTGGGTACTGCTGG - Intronic
1142684237 17:1568435-1568457 GGCACGATTCTAGGCACTGGGGG + Intergenic
1142717542 17:1755280-1755302 GTCACCGTTCTGGGCATGGGTGG + Intergenic
1142743942 17:1945800-1945822 GCCAGTGTTCTGGGCCCTGAGGG - Intronic
1143094853 17:4473315-4473337 GGCTCTGCTCTGTGCAGTGGTGG - Intronic
1143347128 17:6258089-6258111 GGCACTGTGCTCGGCACTGGAGG - Intergenic
1144209630 17:13003427-13003449 GTAACTCTTCTGGGCAGTGGTGG - Intronic
1144333730 17:14249734-14249756 GGCACTGTGCTGGGTCCTGGAGG - Intergenic
1144702223 17:17347244-17347266 GCCACTGTTCAGGGGGCTGGTGG + Exonic
1144736324 17:17557584-17557606 AGTACTGTTCTGGGCGCTGTGGG - Intronic
1144763131 17:17718562-17718584 GGCGTTGTTCAGGGCACTGTGGG - Intronic
1144827074 17:18111443-18111465 AGCACTGTGCAGGGCACTTGGGG - Intronic
1145232484 17:21184197-21184219 GGCACTCTGCTGGGCATAGGAGG + Intronic
1145260848 17:21353629-21353651 GGCACTGTGCTGGGCACTGGGGG + Intergenic
1146442933 17:32912886-32912908 GGCACTGTTCTAGATATTGGGGG + Intergenic
1146516967 17:33497000-33497022 GGCAAAGTGCTGGGCACTGAGGG - Intronic
1147161366 17:38571281-38571303 GGTACTGTACTGGGCACAGCAGG - Intronic
1147179619 17:38675960-38675982 GCCACTGTTCTAGGCAGTGGGGG - Intergenic
1147250066 17:39147823-39147845 GGCACTGTGCTGGGTGCTGGGGG + Intronic
1147760142 17:42792712-42792734 GGCATTGTGCTGGGTACTGTGGG - Intronic
1147857396 17:43492600-43492622 GGCACTGTACTGGGTGCTTGGGG + Intronic
1147934759 17:44005206-44005228 GGCGCTGGTCTGGGCCCTGCCGG - Intronic
1147979298 17:44264952-44264974 GGCATTGTGTTGAGCACTGGAGG + Intronic
1147986587 17:44310604-44310626 GGAGCTGTTCTGGGAGCTGGAGG - Intronic
1148945968 17:51261545-51261567 GACATTGTTCTAGGCACTGGAGG + Intronic
1148955466 17:51350339-51350361 GGCCCCTTTCTGGGCACTGATGG - Intergenic
1148961189 17:51394270-51394292 GGCACTGTTCTGGAGCCAGGAGG - Intergenic
1149510673 17:57238644-57238666 GGCATTGTTCTAGGTGCTGGAGG + Intergenic
1149542006 17:57474453-57474475 GGCACTGTCCTGTGCATTGTAGG + Intronic
1149986938 17:61354513-61354535 AGCACTGTTTTGGACAATGGAGG - Intronic
1150234750 17:63583916-63583938 GGGACTGTCCTGGGCACTGTAGG - Intronic
1150301348 17:64049621-64049643 GGCACCATTCTGGGCCCTGGGGG - Intronic
1150335209 17:64326028-64326050 GGCTCTGGGCTGGGCAGTGGGGG + Intronic
1150597177 17:66616512-66616534 GGCACCGTGCTAGGCACTGGGGG + Intronic
1151325804 17:73379277-73379299 GGTGCTGCTGTGGGCACTGGAGG + Exonic
1151378983 17:73711843-73711865 GTCACTGTGCAGGGCACTCGGGG - Intergenic
1151421500 17:74001028-74001050 AGAACAGTTCTGGGCCCTGGGGG - Intergenic
1151585442 17:75005523-75005545 GGCACTGTGATGGGAGCTGGTGG + Exonic
1151689225 17:75670942-75670964 GGGAGTGTTCTGGGTAGTGGAGG + Intronic
1151956318 17:77381861-77381883 AGCTCTGTTCTAGGCACTGGGGG + Intronic
1152028366 17:77826304-77826326 GGCACTGTGCTAGGCACAGAAGG - Intergenic
1152401033 17:80066230-80066252 GGCTCTGTGCTGGGCACAAGGGG - Intronic
1152926050 17:83088266-83088288 GGCACAGGTCTGGGCACGGCCGG - Intronic
1152931700 17:83113377-83113399 CACCTTGTTCTGGGCACTGGGGG + Intergenic
1153147351 18:2048365-2048387 GGCACTGTGCTAGACACTGAGGG - Intergenic
1153160491 18:2199389-2199411 GATGCTGTTCTGGGAACTGGAGG - Intergenic
1153324562 18:3804710-3804732 GGTACTGTTCAGGGCACTTTAGG + Intronic
1153687917 18:7565436-7565458 GGCACTGTGCTAAGTACTGGAGG - Intergenic
1154164466 18:12004027-12004049 TGCTCTGTGCTGGGCACTGCAGG - Intronic
1154181657 18:12144192-12144214 GGCTCTGTTCAGGGCATTGCAGG + Intergenic
1154182247 18:12147392-12147414 GGCTCTGTTCAGGGCATTGCAGG - Intergenic
1154463869 18:14623501-14623523 GGCACTGTGCTGGGAACTAAAGG + Intergenic
1154509185 18:15077080-15077102 GGCATTGTTCTAGGTTCTGGAGG + Intergenic
1155295828 18:24383892-24383914 GGGGCTGTTATAGGCACTGGAGG + Intronic
1155404452 18:25472704-25472726 GGCACTCTTCTAGACACTGAAGG - Intergenic
1156850764 18:41723298-41723320 AGCACTGTGCTAGGCACTGGGGG - Intergenic
1156921590 18:42529156-42529178 GGCAGTGTCCTGGGGAATGGGGG - Intergenic
1157162794 18:45329721-45329743 AGCACTGTGCTGGGCACTGTGGG - Intronic
1157596751 18:48868873-48868895 TGCACATTTCTGGGAACTGGAGG - Intergenic
1157879102 18:51303138-51303160 GGCACTGTTCTAGGCAGTTGAGG + Intergenic
1158429270 18:57369598-57369620 AGCACTGTTCTAGGCATCGGGGG - Intronic
1159058124 18:63486747-63486769 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1160151972 18:76402197-76402219 GGGATTGTTGTGGCCACTGGCGG - Intronic
1160581228 18:79885633-79885655 GGCACTGTCCTAACCACTGGTGG - Intronic
1160740483 19:683278-683300 GGCACTTTTCTGGGCACCACAGG - Exonic
1160990897 19:1859934-1859956 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1160996230 19:1883324-1883346 GGGTCTGTCCTGGGCACTGCAGG - Intronic
1161028445 19:2047296-2047318 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161121187 19:2527707-2527729 GGGGCTGTCCTGGGCACTGCAGG + Intronic
1161123906 19:2545263-2545285 GGGCCTGTCCTGGGCACTGCAGG - Intronic
1161138760 19:2636004-2636026 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161141994 19:2653623-2653645 GGGGCTGTCCTGGGCACTGCGGG + Intronic
1161144687 19:2670679-2670701 GGGGCTGTGCTGGGCACTGCAGG + Intronic
1161154717 19:2726716-2726738 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161162617 19:2769461-2769483 GGAGCTGTCCTGGGCACTGCAGG - Intronic
1161165995 19:2787827-2787849 GGAGCTGTCCTGGGCACTGCAGG - Intronic
1161212807 19:3076381-3076403 GGGGCTGTCCTGGGCACTGCAGG + Intergenic
1161221561 19:3120382-3120404 GGGGCTGCTCTGGGGACTGGTGG - Intronic
1161280509 19:3443050-3443072 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161281066 19:3446004-3446026 GGAGCTGTCCTGGGCACTGCAGG - Intronic
1161323175 19:3650541-3650563 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161377726 19:3948815-3948837 GGGGCTGTCCTGGGCACTGCAGG - Intergenic
1161424609 19:4196089-4196111 GGGGCTGTCCTGGGCACTGCAGG - Intronic
1161551425 19:4914978-4915000 GGGACCGTCCTGGGCACTGCAGG + Intronic
1161553719 19:4928705-4928727 GGGACCGTCCTGGGCACTGCAGG + Intronic
1161751409 19:6099959-6099981 GAGACTGTTCTGTGCACTGTAGG - Intronic
1161864234 19:6822037-6822059 GGCACTGTCCTGGGGTCTTGGGG + Intronic
1161873379 19:6887873-6887895 GGTGCTGTTCTAGGCACTAGAGG + Intronic
1162198226 19:9002159-9002181 GGCACTGTTCTAGGCAATGAGGG - Intergenic
1162795993 19:13088043-13088065 GGCACAGGTCTGGCCACTGGAGG - Intronic
1162850929 19:13430652-13430674 GGCTGTGTTCTAGGCTCTGGGGG + Intronic
1162903523 19:13809361-13809383 GGCATGGTACTGGGCACTGGTGG + Intronic
1162910487 19:13845191-13845213 GGCTCTGTTCCGGGCATTTGGGG + Intergenic
1162958477 19:14112820-14112842 GGCACTGCTCTGGGCACATCAGG - Intronic
1163255949 19:16155951-16155973 GGGGCTTTCCTGGGCACTGGTGG + Intronic
1164444791 19:28307907-28307929 GGCGCTGTTCTTGGTTCTGGAGG - Intergenic
1164860051 19:31555568-31555590 GGCACTGTGCTGGACACAGAAGG - Intergenic
1165098406 19:33423190-33423212 AGCACTGTTCTGGTCTCTTGAGG - Intronic
1165132908 19:33644329-33644351 GGTACTGTTCTAGGCACTGGGGG + Intronic
1165393226 19:35550080-35550102 GGCTGTGTACTAGGCACTGGAGG + Exonic
1165487981 19:36106945-36106967 GGCAAGGTTTTGGGCAATGGTGG - Intergenic
1165785987 19:38462388-38462410 GGCACTGGTCTGGGGACAGGGGG - Intronic
1165993790 19:39830957-39830979 GGCCCTGCTGTAGGCACTGGAGG - Intronic
1166122553 19:40694173-40694195 GGGTCTGGTCTGGGGACTGGTGG - Intronic
1166327759 19:42061734-42061756 GACACTGGTCTGGGCCCAGGTGG - Intronic
1166545662 19:43633537-43633559 AGCACTCTTCTGGGTACTAGGGG - Intronic
1166614260 19:44228890-44228912 GGCACTGTCCTGTGCACTGTAGG - Intronic
1166891020 19:45993175-45993197 GGCACTTTTCTGGGTGCTGGAGG - Intergenic
1166942664 19:46376108-46376130 GGCACTGTCCTAGGCACTAGGGG + Intronic
1166965263 19:46526108-46526130 GGCACTGTCCTAGGCACTGGGGG - Intronic
1167064420 19:47173594-47173616 GGGACTGTCCTGTGCACTGTGGG + Intronic
1167093683 19:47361883-47361905 GGCACTGCACTAGGCACTAGGGG - Intronic
1167207975 19:48115412-48115434 GGGTCTGTGCTGGGCTCTGGGGG - Intergenic
1167704946 19:51076361-51076383 GGCATTGTTCTGGGTGCTGGAGG - Intergenic
1167810014 19:51821450-51821472 GGGACTGTTCTGTGCACAGTAGG - Intronic
1168645444 19:58056356-58056378 GAGACTGTTCTAGGCACAGGAGG - Intergenic
925153409 2:1632869-1632891 GGCACAGTGCTGGGCACACGAGG - Exonic
925379924 2:3417592-3417614 GGCACTGTGCTAGGCTCGGGGGG - Intronic
926147831 2:10407495-10407517 GGCCCTGTTTTGGGCCCTGTGGG + Intronic
927429640 2:23016449-23016471 AGCACTGTACTAGGCACTGTTGG - Intergenic
927485068 2:23483118-23483140 GGCATTGTTGTAGGCACCGGGGG + Intronic
927827954 2:26322654-26322676 TGCACGGTGCTAGGCACTGGGGG - Intronic
927915025 2:26930096-26930118 GGCACTGATCAGGGCAGTGAGGG - Intronic
928285656 2:29988009-29988031 GTAACTGCTCTGGGCACTTGGGG - Intergenic
928525178 2:32132591-32132613 GTAACTATTCTGGGGACTGGAGG - Intronic
929641785 2:43587809-43587831 AGCACTCTTCTAGGAACTGGGGG - Intronic
930101032 2:47603152-47603174 GGCACTGTTCTGGAAGCTGGGGG + Intergenic
930217970 2:48716402-48716424 GGCACTGTTCTAGATACAGGAGG + Intronic
930224629 2:48779643-48779665 GGCACGGTGCTGGGTACTGGAGG - Intergenic
931070115 2:58637439-58637461 GGCACAGTGCTGGGCACTTAGGG + Intergenic
931229911 2:60365461-60365483 GGCTCTGTTGGTGGCACTGGCGG - Intergenic
931257115 2:60583434-60583456 GGCACTGATGGAGGCACTGGGGG - Intergenic
931492465 2:62763341-62763363 AGCACTGTTCTAGGCCCTGGAGG - Intronic
931731077 2:65153997-65154019 GGCACAGTTCTGGGCTCCAGAGG - Intergenic
931818778 2:65930936-65930958 GGCACTGAACTAGGCACTGGGGG - Intergenic
931917736 2:66977421-66977443 AGCATTGTTCTTGGCACTGGAGG - Intergenic
931944394 2:67288781-67288803 GATACTATTCTAGGCACTGGGGG + Intergenic
932144726 2:69307196-69307218 GGCACTTTTCTAGGCCCTGGGGG - Intergenic
932221751 2:70004919-70004941 GGCACTATTCTAAACACTGGGGG - Intergenic
932821362 2:74904172-74904194 GGGTCTGTTCTGTGCACTGTAGG + Intergenic
933187652 2:79296565-79296587 GGCACTGTAGTAGGCACTGTGGG + Intronic
933676596 2:85063014-85063036 GGCACTGTTCTAGGCACTTGGGG + Intergenic
934113050 2:88759928-88759950 GCTACTGTTCTGGGGTCTGGAGG - Intergenic
934538936 2:95159140-95159162 GGCCCTGCTCTGGGCCCTGCAGG - Intronic
934698938 2:96423199-96423221 GGCCCTGTTCTTGACACTTGGGG + Intergenic
934940415 2:98497415-98497437 GCTACTATTCTGGGCTCTGGAGG - Intronic
935084106 2:99827846-99827868 GGCTCTGTTCTCGGCGCTGGGGG - Intronic
935599888 2:104912155-104912177 GGCACTGCTCTGTGCAGTGACGG - Intergenic
935732667 2:106077149-106077171 TGCCCTGTGCTGGGCACTGGAGG - Intronic
936272116 2:111056928-111056950 AGCACTGTGCTAGGCACTGAGGG + Intronic
937369227 2:121286010-121286032 TGCACTGTTCTAGGCAGTGCAGG - Intergenic
937941344 2:127288468-127288490 GGCCCTGGCCTGGACACTGGGGG - Intronic
938116728 2:128607427-128607449 TGCACTGTTTTAGGCCCTGGAGG - Intergenic
938241846 2:129748235-129748257 GGAACATCTCTGGGCACTGGTGG + Intergenic
938341667 2:130540185-130540207 CGCATTGTTCAGGGCACAGGAGG + Intronic
938348162 2:130580524-130580546 CGCATTGTTCAGGGCACAGGAGG - Intronic
938945321 2:136207156-136207178 GGAACTGTTCAGGACACAGGAGG + Intergenic
939527627 2:143317199-143317221 GGTACTCTTATAGGCACTGGGGG - Intronic
940223916 2:151382319-151382341 AGCACTGTTCTAGGCACTTAGGG + Intergenic
940318548 2:152349928-152349950 GGCAGTGTTGTAGGCACTGGAGG + Intronic
940771375 2:157842433-157842455 GGCACTGATTTAGGCACTGGAGG + Intronic
940851100 2:158688920-158688942 TTCAATGTTCTGGGCACTGTGGG + Intergenic
940955571 2:159723422-159723444 GGGACTGTTCTGGGCAAGTGGGG + Intronic
940994259 2:160130137-160130159 GTTACTGTGCTGGGTACTGGAGG + Intronic
941616843 2:167730005-167730027 TGCACCCTTCTGGGCACTGCAGG - Intergenic
941751702 2:169141454-169141476 GGCACTGTTCTAAGTGCTGGAGG - Intronic
942122415 2:172791381-172791403 GGCCCTGTTTCGGGCACTGTAGG + Intronic
945204041 2:207312762-207312784 GGCACTGTTCTATGTGCTGGTGG - Intergenic
946574079 2:221055528-221055550 AGCACTGTTCTAGACACTGGAGG - Intergenic
947204045 2:227644135-227644157 GGCACTGTTCTGAGCTCTGTAGG - Intergenic
947378028 2:229517234-229517256 GGCACTGTTCTAGGAGCTGAGGG + Intronic
947742933 2:232493103-232493125 GGCTCCGGGCTGGGCACTGGGGG - Intergenic
948154332 2:235769214-235769236 GGCACCGTGCCAGGCACTGGGGG - Intronic
948262335 2:236613499-236613521 GGCAGTGTTCTGGGTCCTGTGGG - Intergenic
948617878 2:239213106-239213128 GGGACAGCTCTGGGTACTGGCGG - Intronic
1168731910 20:91569-91591 GGCACTATCCTGGGCCCTTGAGG - Intronic
1168768643 20:399390-399412 GGCCCTGTTCTGGGCAATGCTGG - Intergenic
1168896421 20:1326804-1326826 GGCACTGTGCTCAGCACTGGGGG - Intronic
1168981313 20:2006390-2006412 GGCACCGTGCTGGGTACTTGCGG - Intergenic
1169011893 20:2257975-2257997 GGCACAGTACTTGGCCCTGGGGG + Intergenic
1169038855 20:2476266-2476288 GGCGCTGCTGTGGGCACTGCTGG + Intronic
1169069534 20:2715105-2715127 GGCAGTGGTATGGGGACTGGGGG - Intronic
1169122855 20:3107727-3107749 GGCCCTGTCCTGGGTACAGGTGG - Exonic
1169317830 20:4608125-4608147 GACACTGTTCTAAGCACTTGGGG - Intergenic
1169705645 20:8501343-8501365 GGCACTGTGCTAGGCACCTGGGG - Intronic
1169876207 20:10299648-10299670 GGCATTGTGCTAGGCACTGTGGG + Intronic
1170127067 20:12975822-12975844 GACACTGATCTGTGCATTGGAGG + Intergenic
1170216727 20:13899489-13899511 GGCACTGTCCTCTGCACTGGAGG + Intronic
1170415440 20:16134055-16134077 GGAACTCCTCTGGGCACTGAGGG - Intergenic
1170472654 20:16683709-16683731 GGGACTGTTCTGTGCATTGTAGG - Intergenic
1170593273 20:17787201-17787223 GGCACTGCTGTGGGCACCCGGGG + Intergenic
1170776481 20:19379245-19379267 GGCACTGTACTAGGAGCTGGGGG + Intronic
1171186358 20:23126767-23126789 GGGACTGTCCTGGGCACTGTAGG + Intergenic
1171429980 20:25076947-25076969 AGCCCTATCCTGGGCACTGGAGG - Intronic
1172007030 20:31824653-31824675 GGCCCTGTGCTGGGCACTGGGGG + Intronic
1172050460 20:32113279-32113301 GACATTGTTCTGGGAGCTGGCGG - Intronic
1172098104 20:32470434-32470456 GGCCCTGTGCTGGGTGCTGGAGG + Intronic
1172113188 20:32559520-32559542 GGCACTGCTCGGAGCACTTGAGG + Intronic
1172598903 20:36169940-36169962 GGCACTGTAGTGGCCCCTGGAGG - Intronic
1172814251 20:37673718-37673740 GGAACTTGTCTGGGCACTTGAGG - Intergenic
1173445652 20:43115629-43115651 GGCGCTGTTCTGTGTACTGTGGG - Intronic
1173476857 20:43365679-43365701 GGGGCTGTTCTGTGCCCTGGAGG + Intergenic
1173685846 20:44922890-44922912 GGCATTGTCCTGGGCACTGTAGG - Intronic
1173738759 20:45380806-45380828 GGCACTGTTCTAGGATCTGGTGG - Intronic
1173906144 20:46631237-46631259 GGGGCTGTTCTGGACACTGCAGG - Intronic
1173954235 20:47018350-47018372 GGCACCCTTCTAGGCACTGAGGG + Intronic
1174077153 20:47945791-47945813 GGCGCTGTGCTAGGCACTGGGGG + Intergenic
1174298015 20:49562528-49562550 GGCTCTGTTTTGGGGACTGTGGG + Intronic
1174303629 20:49600107-49600129 GGGACTGTTGTGGGGAATGGGGG - Intergenic
1174415690 20:50365073-50365095 GGGACTGTCCTGGGCGCTGTGGG - Intergenic
1174518058 20:51108569-51108591 GGCACTGTACTGAGCACCTGAGG - Intergenic
1174525251 20:51165324-51165346 GGCAATGTCCTGTGCACTGTGGG + Intergenic
1174527349 20:51184240-51184262 GGCTCTTTTCTGGGCACTTGGGG - Intergenic
1174563969 20:51451481-51451503 GGCGCTGTCCTGGGCACTGCAGG - Intronic
1174584065 20:51593778-51593800 GGCACTGTTCTTGGGGCTGGAGG - Intergenic
1174600989 20:51724682-51724704 GGCCCTGTGCTGGGTTCTGGGGG - Intronic
1174757697 20:53175891-53175913 GGCTCTGTTCTGTTCACTGAAGG - Intronic
1174792274 20:53490336-53490358 GACACTGTCCTAGGCACTGTGGG + Exonic
1174866607 20:54142305-54142327 GGTACTGGTCTGTGCCCTGGGGG + Intergenic
1174899308 20:54481645-54481667 GGCCCTGCACTAGGCACTGGGGG - Intronic
1174988803 20:55486626-55486648 GGTGCTGTGTTGGGCACTGGAGG - Intergenic
1175234243 20:57498940-57498962 GGCGCTGTTCTGGGCACTGTAGG + Intronic
1175344237 20:58260275-58260297 GGCACTGTGCTGGGTGCTGATGG + Intergenic
1175400601 20:58698005-58698027 AGCACGGTTCTGGGCACGGAGGG - Intronic
1175421297 20:58835732-58835754 GACACTATTCCGGGCACTGTGGG - Intergenic
1175578824 20:60082897-60082919 TGCACTGTGTTGGGCAGTGGAGG + Intergenic
1175590133 20:60182861-60182883 GGCGCTGTTCCGGGCTCTGGAGG - Intergenic
1176060559 20:63170739-63170761 GGCACTCTCCTTGTCACTGGGGG - Intergenic
1176725088 21:10425003-10425025 GGAACTGTGCTTAGCACTGGTGG - Intergenic
1176788884 21:13294734-13294756 GGCATTGTTCTAGGTTCTGGAGG - Intergenic
1176810662 21:13534872-13534894 GGCACTGTGCTGGGAACTAAAGG - Intergenic
1177988048 21:28002874-28002896 GGCATTGTTCTAGGTTCTGGAGG - Intergenic
1178411902 21:32370917-32370939 GGCACTGTCCTAGGGACTGGAGG + Intronic
1178561936 21:33645980-33646002 GGCACTGTTTTAGGCCCTGGAGG - Intronic
1178581202 21:33839902-33839924 GGGACTGTCCTGTGCACTGCAGG - Intronic
1178928523 21:36795781-36795803 GGCACTATCCCAGGCACTGGGGG - Intronic
1180611556 22:17101517-17101539 GGCCCTGTTCTTGGCACTGGAGG - Intronic
1181023280 22:20114302-20114324 GGCACTGCTCTGGGCTCGGCAGG - Intronic
1181539854 22:23567214-23567236 GGCACTGTTCTAGGCCGTGGGGG + Intergenic
1181553332 22:23653383-23653405 GGCACTGTTCTGGATGGTGGAGG - Intergenic
1181645948 22:24231984-24232006 AGCCAAGTTCTGGGCACTGGGGG - Intronic
1181744152 22:24944153-24944175 GGAACTGTTCTAGGTCCTGGAGG + Intronic
1181771013 22:25125608-25125630 GGAGCTGTCCTGGGCACTGTAGG + Intronic
1181925963 22:26358876-26358898 GGGGCTGTCCTGGGCACTGGAGG - Intronic
1181980555 22:26762981-26763003 GGCTCTGTACTGGGTGCTGGAGG + Intergenic
1182319246 22:29467609-29467631 AGCACCAGTCTGGGCACTGGGGG - Intergenic
1182608981 22:31530540-31530562 GACACTGTGCTAGGTACTGGAGG + Intronic
1182654987 22:31883066-31883088 GGAAGTGTTCTGTGCACTGGAGG + Intronic
1182721899 22:32409731-32409753 AGCACTGTCCTGGGCACTAGGGG + Intronic
1182796706 22:32996212-32996234 GGCACTGTGCTGGGCTCTGAGGG + Intronic
1182899201 22:33884014-33884036 GGCACTGTTCTAAGTACTGTGGG - Intronic
1183019640 22:35016902-35016924 CTCACTGTGCTGAGCACTGGGGG - Intergenic
1183107488 22:35625059-35625081 GGCTCCGTGCTGGGCTCTGGGGG + Intronic
1183186253 22:36293252-36293274 GGCACTGGCCTGGGCACTGCAGG - Intronic
1183404618 22:37624266-37624288 GGCACTGTTCTAGGCCCTCAGGG + Intronic
1183591614 22:38782432-38782454 GGCACTGTTCTAGGCACTGTGGG - Intronic
1183720958 22:39561052-39561074 AGGCCTGTTCTGGTCACTGGGGG + Intergenic
1183970440 22:41473544-41473566 AGCATTGTTCTAGACACTGGGGG + Intronic
1184034163 22:41910710-41910732 GGCCCTGTTCCAGGCGCTGGAGG - Intronic
1184099477 22:42334511-42334533 GCCACTGTTCTAGGAGCTGGAGG + Intronic
1184333667 22:43841048-43841070 GGCACTGCTCTTGGCATTGGGGG - Intronic
1184439057 22:44497796-44497818 GGACCTGCTCTGGGCCCTGGAGG + Exonic
1184639751 22:45864180-45864202 GGGCCTGTTCCGGGCACTGCTGG - Intergenic
1184784502 22:46665192-46665214 GGCTCTGTGCTGGGCACAGATGG + Intronic
1185393324 22:50574140-50574162 GGCTCTGCTCTGGGCCCTGTGGG + Intronic
949382215 3:3458996-3459018 AGCATTGCTCTGGGCACTGGAGG + Intergenic
949421895 3:3874662-3874684 GGTATTTTTCTAGGCACTGGTGG - Intronic
949870511 3:8583971-8583993 GGCAGTGTGCTAGGCTCTGGGGG - Intergenic
950027125 3:9827725-9827747 TGCACTGTTCTGGGCACTTGGGG + Intronic
950127307 3:10517820-10517842 GGCACTGTGCCGGGCACAGCAGG + Intronic
950218615 3:11177682-11177704 AGCACTGTGTTGGGCACTGGAGG - Intronic
950298412 3:11852092-11852114 GGCACTGTACTAGGCACTAAAGG - Intergenic
950429403 3:12942195-12942217 GGCACTGCTCTGGGCTCTGGGGG - Intronic
950563479 3:13749520-13749542 GGCACTGTTTTCACCACTGGGGG - Intergenic
950683163 3:14599153-14599175 GGCCTTGTTCTGGGTATTGGGGG - Intergenic
950900225 3:16490952-16490974 GGCACTGTCCTAAGCACTGAGGG + Intronic
951633831 3:24751322-24751344 TGCACTCTGCTAGGCACTGGGGG + Intergenic
951902151 3:27667301-27667323 GGCATTATACTGGGCATTGGAGG + Intergenic
952070597 3:29630448-29630470 GGCACTGTAGTAGGCACTGGGGG - Intronic
952207940 3:31199109-31199131 GCCACTGTGGTGGTCACTGGAGG - Intergenic
952494351 3:33902805-33902827 GGCCCTGTGCTGGGCTCTGGGGG + Intergenic
952755022 3:36858324-36858346 GGCACTGTTCTGTGCGTTGTAGG - Intronic
952816237 3:37450586-37450608 GGCACTGAGCTGGGCCTTGGGGG + Intergenic
952881351 3:37987887-37987909 GGCACCGTTCTAGACACAGGTGG + Intergenic
953281933 3:41567203-41567225 GGCACTGTAGTAGGCACTTGAGG + Intronic
953384894 3:42500981-42501003 GGCCCTGTGCTGTGCACTGGGGG - Intronic
953535835 3:43776103-43776125 GGCACTGTGCTGGCCTCTGCAGG + Intergenic
953573812 3:44096676-44096698 GGCACTGTTCTTGGCATTAGAGG + Intergenic
953666502 3:44929700-44929722 GGCACTGTGCTTGGCACTGGGGG - Intronic
953886096 3:46715135-46715157 GGCCCTGGCCTGGACACTGGGGG - Intronic
954865848 3:53728799-53728821 GGCACTGTTGTGGGTGCTGAGGG - Intronic
955399148 3:58578947-58578969 GGCACTGTTCTAAGTGCTGGGGG + Intronic
955408906 3:58643232-58643254 GGCTCTGTACAGGACACTGGGGG - Intronic
955436178 3:58901111-58901133 AGCACTGTGCTAGGCACTGCAGG - Intronic
955666240 3:61351915-61351937 GCCACTGTTCTAGGCACTAGGGG + Intergenic
955689034 3:61572616-61572638 GGTGCTGTTCTAGGCACTGGGGG + Intronic
956058098 3:65321955-65321977 GGTACTGTTCTGGGTGCTGAGGG + Intergenic
956846150 3:73184887-73184909 GGGACTGTTCTGTGCATTGCAGG - Intergenic
956904528 3:73752152-73752174 GGCACTGTCCTGGGCACCATGGG - Intergenic
957439011 3:80217848-80217870 GGCACTGATCTGGGCACACTGGG + Intergenic
958720642 3:97838627-97838649 GGCACCGTTCTTGGTGCTGGGGG - Intronic
958899705 3:99871410-99871432 GGTACTTTCCTAGGCACTGGAGG + Intronic
958950195 3:100408339-100408361 GGCACTGTGCTGGTCACAGTAGG - Intronic
959678153 3:109060788-109060810 GCCTCTGTTCTGTGCTCTGGGGG - Intronic
959684895 3:109134388-109134410 AGCACTGTGCTAGGCACTGAAGG + Intergenic
960142248 3:114162450-114162472 GGCCCTGCTCTGGGAGCTGGGGG - Intronic
960593731 3:119389916-119389938 GGCACTGCTCTGTGCATTGCAGG + Intronic
961080190 3:124020344-124020366 GGCACTGTGCTGGGGGCTGCAGG + Intergenic
961104210 3:124227582-124227604 GACACTGTGCTAGGCACTAGAGG + Intronic
961375540 3:126463020-126463042 GGCACTGTGCTGGGGGCTGAGGG - Intronic
961429645 3:126872198-126872220 GGGGCTGTCCTGGGCACTGTAGG - Intronic
961930851 3:130531239-130531261 GGAACTCTTCTGTGCACTGCAGG + Intergenic
962149055 3:132873318-132873340 GGCCCTGTGCTAGGCATTGGTGG - Intergenic
962611653 3:137082466-137082488 TGCACTGTGATAGGCACTGGTGG + Intergenic
962616286 3:137130154-137130176 GGCTCTGGCCTGGGCCCTGGAGG + Intergenic
962654063 3:137524648-137524670 GGCACTATTGTAGACACTGGAGG + Intergenic
962704549 3:138030308-138030330 GGCACAGTTCTGTGCACTGTAGG - Intronic
962814766 3:138988030-138988052 GGCACTGCTCTGGACACTGGCGG + Intergenic
963214877 3:142733898-142733920 GTTACTGTTCTGGGCATTGCAGG + Intronic
963262299 3:143205245-143205267 GGCATCATTCTTGGCACTGGGGG + Intergenic
963711318 3:148750879-148750901 GGGACTGTTCTGTGCATTGCAGG - Intergenic
963924090 3:150933189-150933211 TGCGCTGTTGTGGGAACTGGGGG + Intronic
964169569 3:153753820-153753842 GGAGCTGTTCTTGGCAATGGGGG + Intergenic
964402529 3:156314182-156314204 GGCACAGTTCAGAGCACTTGAGG + Intronic
964739710 3:159952569-159952591 GTCAATGTTCTAGGCACTGGAGG + Intergenic
964880700 3:161419566-161419588 GGGCCTGTTCTGTGCACTGTAGG + Intergenic
966330062 3:178801913-178801935 GGCACTGTCCTAGGTACTGTGGG - Intronic
966731949 3:183158786-183158808 GGCTCTGTACCAGGCACTGGGGG + Intronic
967109848 3:186283671-186283693 GGCACTCTTCTAAGCACTGAGGG - Intronic
967278325 3:187798233-187798255 GGCACTGTGCTGGGCTCTTAAGG + Intergenic
967302575 3:188030251-188030273 GGCATTGTGCTGGGCTCTGAGGG - Intergenic
967304795 3:188050012-188050034 GGCCCTTTCCTGAGCACTGGAGG - Intergenic
967380808 3:188855654-188855676 GGCATTGTTCTGGAAACTGAGGG + Intronic
967473383 3:189888932-189888954 GGCACTGTGCTAGGGACTGTAGG + Intronic
968288818 3:197523610-197523632 GGCACTGTGCTAGGAACTGGAGG + Intronic
968844127 4:3030479-3030501 GGCACCGTCCTAGGCATTGGGGG + Intronic
969089643 4:4684255-4684277 GGCCCTGTGGTAGGCACTGGGGG + Intergenic
969142858 4:5094956-5094978 GGCCCTGCCCTGGGCACTGTGGG + Intronic
969293095 4:6252999-6253021 GGCAGTGCTCTAGGCACTCGGGG + Intergenic
969527469 4:7711174-7711196 GGGACTGTTCTGGAGAGTGGAGG + Intronic
969605027 4:8198083-8198105 GGGGCTGTCCTGTGCACTGGAGG - Intronic
969808138 4:9626818-9626840 GGGGCTGTTCTGGGCACTGTGGG + Intergenic
970140392 4:12975887-12975909 GGCACCATCCTTGGCACTGGTGG + Intergenic
970160116 4:13179792-13179814 GGGACTGTTCTGTGCATTGTAGG - Intergenic
971076442 4:23154422-23154444 GGCACTGTTCTAATCACTGGAGG - Intergenic
972720207 4:41688782-41688804 GGCACTGTACTGGGTGCTGCAGG + Intronic
973741380 4:53922548-53922570 GGGACTGTCCTGTGCACTGCAGG - Intronic
975211240 4:71702583-71702605 GGCACTGTGCTAGGAACTGAGGG + Intergenic
975294095 4:72712149-72712171 GGCACCGTCCTTGGCAGTGGGGG - Intergenic
975420582 4:74159077-74159099 GGGATTGTGCTGGGCACTGGCGG - Intronic
975454559 4:74575037-74575059 TGCACTGTTCCAGGCACTGAGGG + Intergenic
975642831 4:76517440-76517462 GGCACTGTTCTCAGCTCTGCTGG + Intronic
975643289 4:76522455-76522477 GGCACTGTTCTCAGCTCTGCTGG + Intronic
975937685 4:79601237-79601259 GGCACTATGCTAGGCATTGGAGG - Intergenic
976570435 4:86601902-86601924 GACACTCTACTAGGCACTGGTGG + Intronic
977248381 4:94660642-94660664 GGCATTGTTCAAGGCACTGCAGG - Intronic
977607446 4:98996289-98996311 GGCTCGGGTCTGGGCGCTGGAGG + Intronic
978152622 4:105455128-105455150 GGCACTGTTCTAGGCACTGTGGG - Intronic
978211161 4:106136813-106136835 GGCTCTCTGCTGGGCAATGGAGG - Intronic
979150726 4:117310991-117311013 GGCACACCTCTGGGCACTCGGGG - Intergenic
979209225 4:118079130-118079152 GGCATTGTTCTAGGAGCTGGTGG + Intronic
979571918 4:122237422-122237444 GGCATTATTCTAGGCACTGGAGG + Intronic
980839010 4:138234154-138234176 GACACTGTTCTAAACACTGGAGG - Intronic
981193023 4:141885724-141885746 TGCACTGTTCTAGACACTTGAGG + Intergenic
981716125 4:147754084-147754106 GGCACTGTTCTAGACACTGCTGG - Intronic
982469831 4:155774595-155774617 GACATTGTTCTGGGTACTAGGGG - Intronic
982762961 4:159309413-159309435 GGCACTGTGCTAGGCTCTAGGGG - Intronic
985016652 4:185643202-185643224 GGGACTGTGCTGGGACCTGGAGG + Intronic
985080567 4:186260299-186260321 GGTACTGTTCTGGGCCCCGGGGG + Intergenic
985218610 4:187678733-187678755 CTCACTGTTCTGGGCAATGGTGG + Intergenic
986607851 5:9540168-9540190 GGCACTGTTCTAGGCAGCGTGGG + Intronic
986896311 5:12373931-12373953 AGCACTGAGCTGGGTACTGGGGG + Intergenic
988524242 5:31972560-31972582 GGCACTGTTATAGGCATTTGAGG - Intronic
988801243 5:34698357-34698379 GGCACTGTGCTAGGCACCAGGGG - Intronic
989997779 5:50856007-50856029 GGTACTGTGCTAGGCACTGGGGG + Intergenic
990891019 5:60650405-60650427 GGAGCTGTCCTGTGCACTGGGGG + Intronic
991416102 5:66394612-66394634 GGCTCTGTGCTAGGCACTGTAGG + Intergenic
991570729 5:68050755-68050777 GGCATTGTTCCTGGCACTTGGGG - Intergenic
991918761 5:71632445-71632467 GGCACTGTTCTGGGTGCCTGAGG + Intronic
992007302 5:72490571-72490593 GGCACTGTGCTGGGCATGGAGGG + Intronic
992218751 5:74550854-74550876 GGCACTGTGCTAGGCACTGTAGG + Intergenic
992417518 5:76566134-76566156 GGCACTATTCTAGGCACTAATGG + Intronic
993754466 5:91710912-91710934 GCCACTACTCTGGGCACTGGTGG + Intergenic
994069841 5:95588618-95588640 GGCACTATGTTGGGCACTGGGGG + Intronic
994676867 5:102834379-102834401 GGCACTGTGCTAGGTACTGGTGG + Intronic
995174913 5:109165118-109165140 GGCACTGTTCTAGGCAAGGCAGG - Intronic
995523170 5:113029957-113029979 GGCACGGTGCTCAGCACTGGGGG - Intronic
996382211 5:122873670-122873692 GGCACTGTACTGAGCCCTGGAGG + Intronic
996555578 5:124775691-124775713 GGCACTGTGGTAGGCACGGGGGG + Intergenic
997136395 5:131330684-131330706 GGCACTGTCCTGTGCATTGTGGG - Intronic
997270063 5:132528979-132529001 GGCACTGTTCTAAGTATTGGTGG - Intergenic
997714383 5:136030939-136030961 AGCACTCTTCTGGGCTCTGAAGG - Intronic
998006853 5:138662778-138662800 GGCGCTGTCCTGGGTGCTGGAGG - Intronic
998531483 5:142889244-142889266 TACACCGTTCTGAGCACTGGAGG + Intronic
998725514 5:145008786-145008808 GGCACTGATATAGGCACTGAGGG - Intergenic
998885744 5:146692125-146692147 GGCACTGTTCTGGGTGCTGGTGG - Intronic
999204930 5:149840995-149841017 AGCACAGTTCTGGGCGTTGGAGG + Intronic
999721077 5:154399734-154399756 AGCACTGTGCTAGGCACTGGGGG + Intronic
1000004178 5:157167675-157167697 GGCACTGCAGTTGGCACTGGGGG - Intronic
1001180486 5:169515398-169515420 CTCACAGTTCTGGACACTGGAGG + Intergenic
1001320135 5:170674060-170674082 GGGGCTGTTCTGGGCATTGTAGG + Intronic
1001363473 5:171111909-171111931 GCCATTTTTCTGGGCACTAGAGG - Intronic
1001690716 5:173630739-173630761 GGCACTGTGGTGGGCACTGGGGG + Intergenic
1001949606 5:175807057-175807079 GCCTCTGTGCTGGGCACTGGTGG - Intronic
1002102075 5:176862618-176862640 GGCACTCTGCTGGGCACCTGCGG - Exonic
1002160030 5:177309614-177309636 GGCCCTATTCTAGGCACTGGGGG - Intronic
1002160941 5:177313731-177313753 GGCGCTGTGCTGGGGGCTGGAGG + Intergenic
1002281703 5:178134052-178134074 GGCCCTAGTCTGGGCACTGAGGG + Intronic
1002761679 6:207306-207328 GTCACTGTTCTAGGCACTGAGGG + Intergenic
1002878562 6:1232728-1232750 GGGACTGTCCTGTGCACTGTAGG - Intergenic
1002935007 6:1663962-1663984 GGCACTGCTCTGGGTCCTGAGGG - Intronic
1004005621 6:11634815-11634837 GGCACTGCTCTGGGCACCAGAGG + Intergenic
1006107957 6:31728121-31728143 GGCGCAGTTCTGGGCCCGGGAGG - Intronic
1006132284 6:31877001-31877023 GGCACTGCTCCGGGGGCTGGCGG - Intronic
1006317183 6:33297943-33297965 GCCACGGTTCTGGGACCTGGAGG - Intronic
1006379619 6:33689947-33689969 GGCTCTGAGCTGGGCACTGGGGG + Intronic
1006581890 6:35082131-35082153 GTCCCTGTCCAGGGCACTGGTGG - Intronic
1006728129 6:36214696-36214718 GGCACTGTTCTAGGCATTGGGGG + Intronic
1006851346 6:37101082-37101104 GGCACTGAGCTAGGCACTGGAGG - Intergenic
1007125378 6:39421841-39421863 GTCACTGTGCTGGGCTCTGTGGG + Intronic
1007142449 6:39589442-39589464 AGCACTGTTCTCCGCAGTGGGGG - Intronic
1007291918 6:40793961-40793983 GGCACTGTGTTGGGCACGGGGGG + Intergenic
1007363061 6:41372366-41372388 GCCACTATTATGGGCACTGCCGG + Intergenic
1007366443 6:41397505-41397527 GGCAAAGTCCTAGGCACTGGGGG - Intergenic
1007382833 6:41501940-41501962 GACACTGTTCTAGGCACTGGGGG - Intergenic
1007776163 6:44225618-44225640 GGCACTGTCCTAGGCACGAGGGG - Intronic
1008048416 6:46874944-46874966 GGAACTGTTCTGTGCATTGTAGG - Intronic
1008662033 6:53678300-53678322 GGCACTGTACTAGGCAAAGGGGG + Intergenic
1008966780 6:57320797-57320819 GGGATTGTTCTGTGCACTGTAGG + Intronic
1009409985 6:63355316-63355338 GGCACTGTTCTAAGTACTTGGGG + Intergenic
1009801401 6:68541304-68541326 GGCACTGTTCTGTATACTTGGGG - Intergenic
1011312596 6:85996761-85996783 GGGACTGTCCTGTGCACTGTAGG + Intergenic
1011465142 6:87647671-87647693 GTCACTGTTCTGGGCATTTGAGG - Intronic
1012491460 6:99787290-99787312 GGGACTGTTCTGTGCATTGTAGG + Intergenic
1012981908 6:105839963-105839985 GGCACTCTTCTGGGCTCAAGGGG + Intergenic
1013581594 6:111540264-111540286 GGCACTATGCTAGGCACTGCAGG - Intergenic
1013639384 6:112058442-112058464 GGCACTGTGCTAGGTGCTGGTGG + Intronic
1014305225 6:119732896-119732918 GGTACTGAGCTGGGCACTGATGG + Intergenic
1014402856 6:121012671-121012693 GGCACTCTTCTGGGCACTGGGGG - Intergenic
1015593193 6:134842169-134842191 GGTACTGTTCTAAGCACCGGGGG - Intergenic
1015669043 6:135666908-135666930 GGCACTCTTCTGGACACTGAGGG + Intergenic
1015962565 6:138665516-138665538 GGCAGTGTGCTGGGCATTGCTGG - Intronic
1016285919 6:142473250-142473272 TGCAATGATCTGGGCACTGCAGG + Intergenic
1016356148 6:143220388-143220410 GGCACTTTTCTGGATGCTGGGGG - Intronic
1017606642 6:156141994-156142016 TGCACTGTTCTGTGCAATGGGGG + Intergenic
1017771835 6:157650089-157650111 GGCTCTGTGCCAGGCACTGGGGG + Intronic
1018131493 6:160736141-160736163 TGCACTGTTGTAGGCATTGGTGG + Intronic
1018167921 6:161116716-161116738 AGCACTGTACTGGGCACAGAGGG - Intronic
1018396272 6:163380207-163380229 GGCACTGGTGGGGGCACAGGGGG - Intergenic
1018793226 6:167165882-167165904 TGCACAGTGCTAGGCACTGGAGG + Intronic
1018804670 6:167249478-167249500 GGCAATGATCTGGGCTCTGCAGG + Intergenic
1018825976 6:167408196-167408218 GGCAATGATCTGGGCTCTGCAGG + Intergenic
1019018391 6:168897067-168897089 GCCACTGTCCTGGACACTGAAGG + Intergenic
1019289290 7:242500-242522 AGCACTGTTCGGTGCACTGGGGG + Intronic
1019501240 7:1365752-1365774 GGCACTGTTCTAGGCACTGGGGG + Intergenic
1019781339 7:2941972-2941994 GGCACTGTGCTAAGCACTGTGGG - Intronic
1019933702 7:4240659-4240681 GGCGCTGTCCTGGGGGCTGGCGG + Intronic
1020091626 7:5345285-5345307 AGCCCTGTTTTGGGCACTTGAGG - Intronic
1020383350 7:7569599-7569621 AGCACTGTACTGGGGACTAGAGG + Intronic
1020929468 7:14374770-14374792 GGCACTGTCCTGTGCATTGTAGG + Intronic
1021195794 7:17673019-17673041 GGAACTGATCTGGGCAGTGCTGG + Intergenic
1021751395 7:23804393-23804415 GGCACAGTTCTAGGCATTTGAGG - Intronic
1021764448 7:23932740-23932762 GGCACTGTGCTAGACCCTGGGGG + Intergenic
1022454572 7:30547075-30547097 GGCACTGTTCTGGGTGGAGGTGG - Intronic
1022765819 7:33410119-33410141 GTTACTGTTCTGTGCACTGGTGG - Intronic
1023124399 7:36940777-36940799 GGCTCTCTGCTAGGCACTGGGGG + Intronic
1023244226 7:38183330-38183352 GGGACTGTTCTGTGCATTGTGGG + Intronic
1023333884 7:39148195-39148217 GGCACTTTTCTGTAGACTGGTGG + Intronic
1023633327 7:42184534-42184556 GTCACTGTTCTAGGCCCTGAAGG - Intronic
1023633564 7:42186353-42186375 GGCACGGTGCTGGCCACTAGGGG - Intronic
1023980750 7:45068660-45068682 AGCACAGTGCTGGGCACTGCTGG + Intronic
1024195226 7:47052740-47052762 GGCGCTGCACTGGGCGCTGGCGG - Intergenic
1024971812 7:55078311-55078333 GGCACCGCTCTGGGCTGTGGCGG - Intronic
1025254889 7:57377732-57377754 GGGACTGTCCTGGGCACTGTGGG + Intergenic
1027603674 7:80272262-80272284 GGCACTGTGCTAGGTACTGTCGG + Intergenic
1027726270 7:81809976-81809998 GGCACTGCCCTGGAAACTGGCGG + Intergenic
1029471589 7:100758222-100758244 GGCAATGTTCTGTGCAGTTGGGG - Exonic
1030234307 7:107242305-107242327 AGCACTTTTCTGGGCAGTGGGGG - Intronic
1030978775 7:116161719-116161741 GGCACTGTTCTAAGCATTAGAGG + Intergenic
1031013183 7:116545261-116545283 GGTACTGTCCTGTGCACTGTAGG - Intronic
1031103045 7:117506038-117506060 GGCCCTATTCTAGGCACTTGGGG - Intronic
1032242895 7:130179181-130179203 AATACTATTCTGGGCACTGGGGG - Intronic
1032695164 7:134329545-134329567 GGCACTGTTCTAGGTGCTGGAGG - Intergenic
1032708548 7:134443003-134443025 GGCACAGTGCTGGGCACATGGGG - Intronic
1033159789 7:138985060-138985082 GGCAGTGCAGTGGGCACTGGAGG + Intergenic
1033418105 7:141182172-141182194 GTAAGTGTCCTGGGCACTGGGGG + Intronic
1033443465 7:141400536-141400558 GGCACTATTCTGGGAATGGGTGG - Intronic
1034141681 7:148824497-148824519 GCCACTGTACTGGATACTGGAGG - Intronic
1034374505 7:150630463-150630485 GGAACTGTTCTGGGAGGTGGGGG + Intronic
1034612713 7:152386419-152386441 GGAACTGTGCTTAGCACTGGTGG + Intronic
1034860895 7:154593746-154593768 GGCTCTGTTCTAGGCACTCGGGG + Intronic
1035731125 8:1854153-1854175 GACACTGCCCTGGGCCCTGGGGG - Intronic
1036612688 8:10363609-10363631 GGCACAGTTCTCAGCACTGGGGG - Intronic
1037121246 8:15289968-15289990 GGCACTGTTCTAGGTGCTGATGG - Intergenic
1037708580 8:21336556-21336578 GGCACTGTTCTAGGCACTTAGGG - Intergenic
1037821125 8:22135024-22135046 GGCCCTGTGCTGGGCGCTGGGGG + Intergenic
1038461197 8:27718494-27718516 TTCACACTTCTGGGCACTGGGGG - Intergenic
1038505461 8:28080780-28080802 GGCACTGTTCTAGATACTGGGGG + Intronic
1039508076 8:38066707-38066729 GGCACTGTTTTAAGCACTAGGGG + Intergenic
1040301142 8:46188589-46188611 GGCACAGTGCTGGGCACTTCTGG + Intergenic
1041462816 8:58130636-58130658 GGCACTGTTACTAGCACTGGAGG - Intronic
1041633801 8:60119459-60119481 GGTACTGTACTGGGCAGTGCAGG + Intergenic
1041957695 8:63574439-63574461 GGATCTGTTCTGGGCAGTGGAGG - Intergenic
1042333218 8:67604623-67604645 GGCACTGTTCTGGATGCTGAGGG - Intronic
1042404360 8:68386805-68386827 GGAGCTGTCCTGGGCACTGTAGG + Intronic
1043422622 8:80114460-80114482 GGCACTGTTCTAGGCATTTTGGG - Intronic
1043583859 8:81744811-81744833 GGCACTGTGTTAGGCACTGGAGG - Intronic
1043591387 8:81837218-81837240 GGCACTGTTCTGGGTAATAGTGG - Intronic
1044540106 8:93399081-93399103 GGAACTGTTCTGGGCATTGCAGG - Intergenic
1045259272 8:100558036-100558058 GGCTCTGTTCTAAGCACTGGGGG - Intronic
1045325683 8:101116158-101116180 GGGGCTGTCCTGGGCACTGTAGG - Intergenic
1045406002 8:101867379-101867401 GGCACTGTGCTAGGTCCTGGGGG - Intronic
1045506231 8:102780777-102780799 ACCACTGTGCTGGGCCCTGGGGG + Intergenic
1045833877 8:106496996-106497018 TGCACCATTCTGGGCACGGGAGG + Intronic
1046110474 8:109717246-109717268 AGCAGTGTTGTGGGCACTGCAGG - Intergenic
1047190322 8:122673631-122673653 TGCCCTCTTCTGGGCACTGGTGG - Intergenic
1047406673 8:124590975-124590997 GGCACTGGTCGAGGCCCTGGGGG - Intronic
1047677342 8:127217298-127217320 GGCACTGTTCTGTGCATTGTTGG - Intergenic
1047723754 8:127666865-127666887 GGCTCTGTGCTAGGCACTAGGGG - Intergenic
1047909177 8:129508705-129508727 GGCTCTGTGCTGAGTACTGGAGG - Intergenic
1048008339 8:130437234-130437256 GGCACTGTGCTGGGCACAAAGGG + Intronic
1048075098 8:131061514-131061536 GCCACAGTTCTCAGCACTGGGGG - Intergenic
1048235637 8:132687330-132687352 GGCACTCTTCTAAGCACTTGGGG + Intronic
1048339587 8:133528396-133528418 GGCACTGTGCTAGGCATTGAGGG + Intronic
1048341221 8:133539977-133539999 GGCACTTGGCTGAGCACTGGAGG - Intronic
1048567854 8:135622186-135622208 AGCACTGTGGTAGGCACTGGGGG - Intronic
1048636102 8:136297050-136297072 GGCATTGTTCTAGGCATTGAGGG - Intergenic
1049031961 8:140044581-140044603 GGCTCTGTGCTGTGCCCTGGGGG - Intronic
1049119317 8:140720037-140720059 GACACTGTCCCAGGCACTGGGGG + Intronic
1049222908 8:141436017-141436039 GGCACTGTTCGGGGACCTGGTGG - Intergenic
1049257959 8:141623923-141623945 GGCCTTGTCCTGGGCGCTGGCGG - Intergenic
1049386813 8:142347053-142347075 AGCAGTGAGCTGGGCACTGGAGG - Intronic
1049956965 9:702440-702462 TGCACTGTTCTCGGAGCTGGGGG - Intronic
1050108556 9:2191144-2191166 GGGAATGTTCTGGGCACTCTGGG + Intronic
1051583885 9:18706639-18706661 GGGACAGCTCTGGGCACTGGAGG + Intronic
1051937753 9:22465196-22465218 GGCATTCTTCTGTGCACTGGGGG + Intergenic
1052021128 9:23526408-23526430 AGCACTGTGCTGGGCACTCCGGG - Intergenic
1053222940 9:36326798-36326820 GGCCCTGTGCTGGGCTCTAGAGG + Intergenic
1053306016 9:36985496-36985518 GGCCCTATGCTGGGCACTGAGGG + Intronic
1053312911 9:37030570-37030592 GGCCCTGTGCTAGGCGCTGGGGG + Intronic
1053435984 9:38074870-38074892 GGCACTGTTCTGGACACTGGAGG - Intergenic
1053467069 9:38316439-38316461 GGCATTGTTCTGGGGGCTGTCGG + Intergenic
1053826916 9:42034885-42034907 GGCATTGTGCTAGGCACTGGGGG - Intronic
1054603644 9:67152546-67152568 GGCATTGTGCTAGGCACTGGGGG + Intergenic
1054890869 9:70250400-70250422 GGCACTGTCCTGTGCATTGGAGG - Intergenic
1055002099 9:71463164-71463186 GACACTGTTCCAGGTACTGGAGG + Intergenic
1055369642 9:75583524-75583546 ACCACTGTTCTAGGCATTGGGGG + Intergenic
1055660236 9:78496081-78496103 GGCACTTTGCTAGGCAATGGGGG - Intergenic
1056014998 9:82376201-82376223 TGCCCTGTGCTGGGCAGTGGAGG + Intergenic
1056126948 9:83543816-83543838 GGCACTGTGCTTGGCTCTGTGGG + Intergenic
1056501417 9:87213556-87213578 GGCATTGTTCTGGGCAGGGGAGG + Intergenic
1056840784 9:89996638-89996660 GGAAATGTTCTGGGGACTGCCGG + Intergenic
1057135014 9:92681417-92681439 GGCATTGTTCTGGGCATTGTAGG + Intergenic
1057519319 9:95748670-95748692 GACACTGTTCTGGGATTTGGGGG - Intergenic
1057529104 9:95828359-95828381 GCCACTGTCCTGTGCACTGTAGG - Intergenic
1057747187 9:97761724-97761746 GGCACTGTTCTGGACACTGGGGG + Intergenic
1057791969 9:98130602-98130624 GATGCTGTTCTTGGCACTGGTGG + Intronic
1057903319 9:98965984-98966006 GGCGCTGGGCTGGGCTCTGGGGG - Intronic
1058170549 9:101675522-101675544 GGCACTGTCCTAGGTGCTGGGGG + Intronic
1058632089 9:106999859-106999881 GACACTGTGCTGGCCAGTGGGGG + Intronic
1059387220 9:113974022-113974044 GGCACTGACCTGGGTGCTGGAGG + Intronic
1059405320 9:114095535-114095557 GGCACTTTGCTGGGCATTGAGGG - Intronic
1059585295 9:115599478-115599500 GGCCCTGTGCTAGGCACTGAGGG + Intergenic
1059746308 9:117205007-117205029 GGCACTGTGCTGGGCATTGCAGG + Intronic
1059781488 9:117532899-117532921 GGCACTGTGCTGGGCACTGTAGG + Intergenic
1059867395 9:118531073-118531095 ACCACTGTTCTAGGCTCTGGTGG + Intergenic
1060045483 9:120336956-120336978 GGCCCTGTTCTGGTCACCAGGGG - Intergenic
1060296408 9:122346671-122346693 GGCCCTGTGCCAGGCACTGGGGG - Intergenic
1060424318 9:123492120-123492142 GGCTCTGTGCTGGGCACTAGGGG + Intronic
1060459829 9:123840620-123840642 GGCACTGTGCTAGGCCCTTGGGG - Intronic
1060508440 9:124215393-124215415 GGCTCTGTGTTGGGCACTGGGGG - Intergenic
1060774637 9:126364011-126364033 GGCCCTGTGCTGGGTACTGGGGG - Intronic
1060776361 9:126377635-126377657 GGCATTGTGCTTGGCACAGGGGG + Intronic
1060946039 9:127569597-127569619 GGCACTGTTCAGGGTAGAGGAGG - Intronic
1060947086 9:127576150-127576172 AACACTATCCTGGGCACTGGAGG + Intronic
1061085307 9:128394581-128394603 GGCACTGTACTAGGCCCTGGAGG - Intergenic
1061736220 9:132661530-132661552 GGGACTGTCCTGTGCACTGTAGG - Intronic
1061757395 9:132824529-132824551 GGGGCTATTCTGGGCACTGTAGG + Intronic
1061774180 9:132949597-132949619 GGGACTGTGCTGGTCCCTGGGGG + Intronic
1062453076 9:136623588-136623610 GTCACTGATCTGGGCTGTGGTGG - Intergenic
1062625343 9:137439900-137439922 GGCACTGTCCTGGTCTCGGGGGG - Intronic
1062702534 9:137914869-137914891 GGCACTGTTCTAGGTGCTAGAGG + Intronic
1203778494 EBV:87597-87619 GGAACCGGTTTGGGCACTGGAGG - Intergenic
1185587453 X:1250282-1250304 GGGGCTGTCCTGGGCACTGGTGG + Intergenic
1186515505 X:10163816-10163838 GGGGCTGTTCTGGGCAATGTAGG + Intronic
1186806347 X:13143867-13143889 GGCACTAGGCTGGGGACTGGAGG - Intergenic
1186850036 X:13570659-13570681 GGCACTGTTCTAAGCACTTCAGG + Intronic
1186852807 X:13597101-13597123 GGGACTGTCCTGTGCACTGCAGG - Intronic
1186968712 X:14816583-14816605 GGCACTGTCCTGTGCATTGCAGG + Intergenic
1187457746 X:19457817-19457839 GGAGCTGTCCTGGGCACTGTAGG + Intronic
1187978449 X:24729221-24729243 GGTACTGTCCTGGGCATTGTAGG + Intronic
1187983223 X:24781991-24782013 TGCACTGTTCTAGGCACAGGAGG + Intronic
1188550527 X:31359696-31359718 GGCACTGACCTGGGTCCTGGGGG - Intronic
1188694398 X:33172145-33172167 GGCTATGTTCTAGGTACTGGAGG + Intronic
1189102582 X:38206751-38206773 GTCACTGTTGTGGGCAATTGGGG + Intronic
1189711163 X:43813760-43813782 GGCACTGTTCTGGGCACTGGAGG + Intronic
1190000928 X:46685649-46685671 GGAGCTGTTCAGGGCTCTGGGGG + Intronic
1190014368 X:46814084-46814106 AGTACTGTTCTGGGCACTGGGGG - Intergenic
1190303375 X:49068841-49068863 CACACTGTGCTGGGGACTGGGGG + Intronic
1190416564 X:50185725-50185747 GGCATTGTGCTGGGCGCTGAGGG + Intergenic
1190733550 X:53240342-53240364 GGGACTGTCCTGTGCACTGTAGG - Intronic
1190738376 X:53270698-53270720 GGCACTGTGTTAGGCACTAGGGG - Intronic
1191901421 X:66044478-66044500 GACACTGTTCTAGGTCCTGGGGG + Intergenic
1191906600 X:66098982-66099004 GGTATTGTTCTGGGAATTGGGGG - Intergenic
1192192391 X:68999319-68999341 GATACTGTTGTAGGCACTGGAGG - Intergenic
1193207205 X:78763002-78763024 GACATTCTTCTAGGCACTGGGGG + Intergenic
1193652350 X:84152656-84152678 GACACTGTGCTGGACACTGGGGG + Intronic
1194314615 X:92360741-92360763 GGCACTATTCTGGGCACTGCAGG + Intronic
1194391476 X:93322613-93322635 AGCATATTTCTGGGCACTGGGGG - Intergenic
1194602928 X:95945331-95945353 GGCTCTGTGCTGGGAGCTGGGGG - Intergenic
1194747366 X:97642750-97642772 GGCACTGTGCTAGGCCCTAGAGG - Intergenic
1195152129 X:102082791-102082813 GACTCTGGTCTAGGCACTGGGGG - Intergenic
1195287207 X:103396784-103396806 GGGGCTGTTCTAGGCAATGGGGG - Intergenic
1195494044 X:105509052-105509074 GGCACAATTCTAGGCATTGGAGG + Intronic
1196188072 X:112765531-112765553 GGCACTCTTCTGGGCTCTGGAGG + Intergenic
1196690878 X:118557120-118557142 GGCATTGTTATAGGTACTGGGGG + Intronic
1196887476 X:120261889-120261911 AGTACTGTTCTGAGCTCTGGAGG - Intronic
1196890282 X:120284712-120284734 GGCTCTGTTCTAGACACTGAAGG - Intronic
1198528358 X:137524712-137524734 GGCACTCTACTGGGCACTGAGGG - Intergenic
1198594532 X:138222207-138222229 GGCACTCTTGTGGGGGCTGGGGG - Intergenic
1198617687 X:138477566-138477588 GGTACTGGTCTGCGCACCGGGGG + Intergenic
1198641564 X:138761616-138761638 GGCACTGTGCTGGACAGTGGAGG - Intronic
1198656653 X:138921825-138921847 TGCACTGTGCTAGGCACTGCAGG + Intronic
1198863853 X:141099325-141099347 AGCACTGTGCTGGGTTCTGGAGG + Intergenic
1198898835 X:141488090-141488112 AGCACTGTGCTGGGTTCTGGAGG - Intergenic
1199777858 X:151031365-151031387 GGCACTGTGCTGGGTACTCAGGG + Intergenic
1200053004 X:153444685-153444707 GGCACTGTCCATGGCACAGGAGG + Intergenic
1200110175 X:153736939-153736961 GGCACTGTATTAGACACTGGGGG + Intronic
1200622668 Y:5472263-5472285 GGCACTATTCTGGGCACTGCAGG + Intronic
1200688739 Y:6283275-6283297 AGCACTGTGCTGGGTTCTGGAGG + Intergenic
1201012926 Y:9566920-9566942 AGCACTGTGCTGGGTTCTGGAGG + Intergenic
1201046533 Y:9891446-9891468 AGCACTGTGCTGGGTTCTGGAGG - Intergenic
1201245133 Y:11996125-11996147 GGGACTGTCCTGTGCACTGTAGG + Intergenic